ID: 1090655440

View in Genome Browser
Species Human (GRCh38)
Location 11:128840157-128840179
Sequence GGCTAGTCTCCAAAGATGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090655440 Original CRISPR GGCTAGTCTCCAAAGATGGA AGG (reversed) Exonic
900039719 1:448619-448641 GGCTAATCTCCAAATATATAAGG + Intergenic
900061151 1:683595-683617 GGCTAATCTCCAAATATATAAGG + Intergenic
902459057 1:16557640-16557662 GCCTTGTCTAGAAAGATGGAGGG - Intergenic
902493098 1:16850276-16850298 GCCTTGTCTAGAAAGATGGAGGG + Intronic
903154170 1:21432761-21432783 TGCTTGCCTCCAAAGAAGGAAGG + Intergenic
904292888 1:29499013-29499035 GGCTAGCCCCCAAGGATGGCAGG - Intergenic
908180869 1:61604185-61604207 TGCTAGTCTCCAGAGAGCGAGGG + Intergenic
909374822 1:74927728-74927750 GGCTTCTCTCCCAAGATGCAAGG + Intergenic
910118874 1:83762004-83762026 CGCTAGTCTGCAGAGAAGGAAGG - Intergenic
913579166 1:120209234-120209256 GGCTATTGTCCAAAGAAGGGAGG - Intergenic
913629007 1:120689132-120689154 GGCTATTGTCCAAAGAAGGGAGG + Intergenic
917418343 1:174834962-174834984 GGTTCCTCTCTAAAGATGGAAGG + Intronic
918082368 1:181217596-181217618 GGCTACTTTCTTAAGATGGAGGG - Intergenic
921198680 1:212782729-212782751 GGGTAGTCTCCAATTATGAAGGG + Intronic
1066668079 10:37806408-37806430 GGCTACTATCAAAAGAAGGAAGG - Intronic
1067716847 10:48696665-48696687 GGCTGAACCCCAAAGATGGATGG + Intronic
1067844950 10:49712298-49712320 GGCTTTTCTCCATAGATGGGGGG - Intergenic
1069945260 10:71981255-71981277 GGCCAGTCTCCAAAGCTGGCAGG - Intronic
1076500775 10:130934398-130934420 GGCTAGACTCCAACCATGGCAGG + Intergenic
1076965942 11:84532-84554 GGCTAATCTCCAAATATATAAGG + Intergenic
1078604415 11:12762650-12762672 GCCAAGTCTACAAAGCTGGAAGG + Intronic
1078983786 11:16568942-16568964 TGCTAGGCACCAAAGATAGAAGG - Intronic
1082213281 11:49533274-49533296 AGCTAGTCTTCAAAAATGAAAGG - Intergenic
1083543991 11:63535741-63535763 GGCTATGCCCAAAAGATGGAGGG - Intergenic
1086636324 11:89091233-89091255 AGCTAGTCTTCAAAAATGAAAGG + Intergenic
1090350532 11:126105013-126105035 GGCTAACCTCCAAAGATGGCAGG - Intergenic
1090655440 11:128840157-128840179 GGCTAGTCTCCAAAGATGGAAGG - Exonic
1091104464 11:132905582-132905604 AGATAGTTCCCAAAGATGGAAGG + Intronic
1099322554 12:81168599-81168621 GACCTTTCTCCAAAGATGGAAGG - Intronic
1104539331 12:129648022-129648044 GTCTGGTCTCCAAACAGGGAGGG - Intronic
1105550335 13:21388853-21388875 GTCTAGGCACCAAAGATGTAAGG + Intronic
1106485708 13:30170879-30170901 GGGCTGTCTCAAAAGATGGACGG - Intergenic
1107751555 13:43572686-43572708 GGGTGCTCTCCAGAGATGGAAGG + Intronic
1116134916 14:40910217-40910239 GGCTAGTGTCTAGAGAGGGAAGG + Intergenic
1117763447 14:59057131-59057153 TAATAGCCTCCAAAGATGGAAGG + Intergenic
1118361964 14:65064439-65064461 GGCTAATGTAGAAAGATGGAGGG - Intronic
1120997578 14:90428127-90428149 GGCGAGGCTCCAAGGATGGAGGG + Intergenic
1121686991 14:95843056-95843078 GGCCAGTCTGCAAAAATGCAGGG + Intergenic
1122475946 14:102009065-102009087 GGCTTGTTTCCAAAGACAGATGG - Intronic
1127763087 15:62159865-62159887 AGCTATTCTCAAAAAATGGAAGG + Intergenic
1128080477 15:64854209-64854231 GGCTGGTGTCCAGAGATGGCCGG + Intronic
1129143404 15:73623976-73623998 AGGCAGTCTCCAAAGATGGATGG - Intronic
1129257577 15:74342808-74342830 CGCTAATCTCCTAAGATGGTGGG - Intronic
1129534998 15:76306204-76306226 ACCTAGTTTCCAAAGATGGTTGG - Intronic
1132442189 15:101878993-101879015 GGCTAATCTCCAAATATATAAGG - Intergenic
1135862981 16:26074337-26074359 GCCTAGTTTGCAAAGATGGCTGG - Intronic
1138607086 16:58096477-58096499 GGCTAGGCTCCAAAGATAGAAGG + Intergenic
1141249341 16:82340653-82340675 GGCTGGTCTCCAAAGATAAGCGG - Intergenic
1141817749 16:86424617-86424639 GGCCTGTCTCCAAACATGGGAGG + Intergenic
1141949318 16:87330540-87330562 GCCTTGGCTCCAAAGCTGGAGGG + Exonic
1146592081 17:34136076-34136098 GCCTAGACTCCAAAGGAGGAGGG - Intronic
1149650907 17:58275818-58275840 GGATAGTTTGAAAAGATGGATGG - Intronic
1150364899 17:64573558-64573580 TGCTAGTCTCAAAAGAGGCAAGG + Intronic
1157193007 18:45597018-45597040 GACAAGTCTCCAAAGAAGGTTGG + Intronic
1160642746 19:154162-154184 GGCTAATCTCCAAATATATAAGG + Intergenic
1163190313 19:15672692-15672714 GGCTCCTCTCCAAACATGGGCGG - Intergenic
1163202868 19:15780743-15780765 GGCTCCTCTCCAAACATGGGCGG + Intergenic
1163875862 19:19866855-19866877 GGCTACTTTCCAAATAAGGAAGG + Intronic
1165131579 19:33635589-33635611 GGCTAGGCCTCAAAGATGGGTGG + Intronic
1165411744 19:35666444-35666466 GGCTAGTCTCCCAGGAAGGAGGG - Intergenic
1166670493 19:44706887-44706909 GATTAGTCTCCCAAGGTGGAGGG - Intronic
926547945 2:14265118-14265140 GGCCAGGCTCCAAAGAAGGCAGG + Intergenic
929032271 2:37660282-37660304 GGACAGTCTCCACAGTTGGAAGG + Intronic
936557194 2:113507083-113507105 GTCTAGTTTCCAAGGATAGACGG + Intergenic
940117298 2:150223166-150223188 TGCTAGTCTCTAGAGATGGGTGG + Intergenic
940847965 2:158661584-158661606 GGCAAGTCTCCAAAGTTACAGGG + Intronic
943642361 2:190373572-190373594 GGCTTTTCTGCAAAGATTGATGG - Intergenic
945493576 2:210483361-210483383 GACTACTTTCCAAAGATGAAAGG - Intronic
946881213 2:224179101-224179123 GTCTAGTCTCAGAAGATGGAAGG - Intergenic
948438326 2:237968337-237968359 GGCTGGGCTCCAAAGATGGTCGG + Intronic
1169090606 20:2859452-2859474 GGCAAGTGTCCAAGGATGGCAGG - Intronic
1177659865 21:24068704-24068726 GGCTTGTGTCCAAGGATAGAGGG - Intergenic
950647150 3:14383873-14383895 GGACAGTCTCCAAAGGTGGCAGG + Intergenic
953981933 3:47417662-47417684 GGCTGGTCCCCGAAGAGGGAAGG + Exonic
955381785 3:58444656-58444678 GACCTGTCACCAAAGATGGATGG - Intergenic
955723225 3:61905417-61905439 AGATAGTGTCAAAAGATGGAAGG - Intronic
962165365 3:133041788-133041810 AGCTAGTCTACACACATGGATGG + Intronic
964824327 3:160808825-160808847 GGCTGCTCTACAAAGATGGGAGG - Intronic
979890685 4:126089677-126089699 GGCTATTCACCAAAGATAAAGGG - Intergenic
980917075 4:139043566-139043588 GGATAGTCTACAAACATGGAAGG + Intronic
984968025 4:185158098-185158120 AGCTAGTCTCCAAAGTTTGGAGG - Intergenic
987471615 5:18337854-18337876 GGATACTCTCCAAAAATGGCAGG + Intergenic
991357354 5:65782724-65782746 GGCCAGTTTCTAAAGATGGAAGG - Intronic
1002655865 5:180746108-180746130 GGATGGTCTCCAAATATTGAAGG + Intergenic
1002734128 5:181370324-181370346 GGCTAATCTCCAAATATATAAGG - Intergenic
1002750413 6:103802-103824 GGCTAATCTCCAAATATATAAGG + Intergenic
1008707442 6:54180484-54180506 GGCTATTTTCTAAATATGGAAGG + Intronic
1017047724 6:150363292-150363314 CCCTAGTCTCCAAAAATGCAAGG + Intergenic
1017555023 6:155554687-155554709 GGCTAGGCTCCAAAGACATATGG + Intergenic
1018619974 6:165720808-165720830 GACCAGTCTCCAGAAATGGAAGG + Intronic
1019238376 6:170642638-170642660 GGCTAATCTCCAAATATATAAGG - Intergenic
1020072293 7:5234984-5235006 GTCTGGTCTACAAAGATGTAGGG - Intergenic
1023336489 7:39175937-39175959 GGCCAGTCTTCCTAGATGGAAGG - Intronic
1024689373 7:51782652-51782674 GGCTAGACTGCAAACATGGTGGG + Intergenic
1027516818 7:79152577-79152599 TGCTGGTTTCCAAACATGGATGG + Intronic
1029374254 7:100168425-100168447 GGGCAGTCACCAAAGCTGGAGGG - Intronic
1029624178 7:101709433-101709455 GACCAGTTTCAAAAGATGGATGG + Intergenic
1034467050 7:151235924-151235946 GGCTAGTCTCCAGAGAAGTGAGG + Intronic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035509393 8:163969-163991 GGCTAATCTCCAAATATATAAGG + Intergenic
1038198575 8:25390685-25390707 GGCTGGTCCCCAGTGATGGAGGG + Intronic
1038561885 8:28587996-28588018 GGGCTGTCTGCAAAGATGGAGGG + Intergenic
1038962491 8:32536990-32537012 GGCTGGTCTCCCAAAATGGTGGG - Intronic
1044817733 8:96130442-96130464 GTCTTGTTTCCTAAGATGGATGG - Intergenic
1044950567 8:97431856-97431878 GGCCAGTCTGCAAAGAGTGATGG + Intergenic
1046564138 8:115877150-115877172 GGCAAGTCCCCAAAGAAAGAAGG + Intergenic
1048651677 8:136485129-136485151 TGATAGTCTCCACTGATGGATGG + Intergenic
1049895803 9:110218-110240 GTCTAGTTTCCAAGGATAGACGG - Intergenic
1053738980 9:41120394-41120416 GTCTAGTTTCCAAGGATAGACGG - Intergenic
1054689366 9:68310922-68310944 GTCTAGTTTCCAAGGATAGACGG + Intergenic
1058932079 9:109730780-109730802 GGATAATCTCCAAAGATGTTAGG + Intronic
1058994781 9:110288914-110288936 GGCTAGGATCTAAAGATAGAGGG - Intergenic
1060864170 9:126981614-126981636 GGCTAGGCTCCTTAGATGTAGGG + Intronic
1062758580 9:138322930-138322952 GGCTAATCTCCAAATATATAAGG - Intergenic
1188304380 X:28544592-28544614 GGTTGGTCTCAAAATATGGAGGG - Intergenic
1197164665 X:123363529-123363551 GGCTATTCTCAAATCATGGATGG + Intronic
1199026265 X:142942442-142942464 GTCTTGTGTCCAAAGTTGGAGGG + Intergenic
1199254023 X:145698170-145698192 GACTGGTCTCCAAATGTGGATGG - Intergenic
1201133857 Y:10975595-10975617 AGATAATCTCCAAAGATGAATGG - Intergenic