ID: 1090661855

View in Genome Browser
Species Human (GRCh38)
Location 11:128888136-128888158
Sequence ATTTTCTCGACAGCCTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090661855_1090661858 28 Left 1090661855 11:128888136-128888158 CCTCCCGAGGCTGTCGAGAAAAT No data
Right 1090661858 11:128888187-128888209 AGCAGAGCTCAGCACATAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090661855 Original CRISPR ATTTTCTCGACAGCCTCGGG AGG (reversed) Intergenic