ID: 1090672030

View in Genome Browser
Species Human (GRCh38)
Location 11:128955027-128955049
Sequence GTGAAATACCGCACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090672030_1090672032 2 Left 1090672030 11:128955027-128955049 CCTTCCACTGTGCGGTATTTCAC No data
Right 1090672032 11:128955052-128955074 TTCTCAGAGCATTTTCTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090672030 Original CRISPR GTGAAATACCGCACAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr