ID: 1090674917

View in Genome Browser
Species Human (GRCh38)
Location 11:128982998-128983020
Sequence TAGGCCCATCTGAATCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090674917_1090674920 -1 Left 1090674917 11:128982998-128983020 CCACAAAGATTCAGATGGGCCTA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1090674920 11:128983020-128983042 AACATGAATTTGAGAGGAAAAGG 0: 1
1: 0
2: 4
3: 50
4: 568
1090674917_1090674922 26 Left 1090674917 11:128982998-128983020 CCACAAAGATTCAGATGGGCCTA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1090674922 11:128983047-128983069 TCATAGTTAGACTCGGCATTAGG 0: 1
1: 0
2: 0
3: 5
4: 52
1090674917_1090674918 -7 Left 1090674917 11:128982998-128983020 CCACAAAGATTCAGATGGGCCTA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1090674918 11:128983014-128983036 GGGCCTAACATGAATTTGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1090674917_1090674921 19 Left 1090674917 11:128982998-128983020 CCACAAAGATTCAGATGGGCCTA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1090674921 11:128983040-128983062 AGGAATATCATAGTTAGACTCGG 0: 1
1: 0
2: 0
3: 27
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090674917 Original CRISPR TAGGCCCATCTGAATCTTTG TGG (reversed) Intronic
901178843 1:7325766-7325788 GTGGCCCCTCTGAATTTTTGAGG - Intronic
903328433 1:22584737-22584759 TTGGCCCACCTGAACCTCTGGGG + Intronic
904704425 1:32379269-32379291 TTGGTCCATCTGAGTCTCTGTGG + Intronic
912078350 1:105907028-105907050 AAGGCCCATATGTGTCTTTGGGG - Intergenic
912583774 1:110743219-110743241 TAGTTCCACCTGAGTCTTTGGGG + Intergenic
916480289 1:165208553-165208575 TAGGCTCATCTCAATCTTAAGGG - Intronic
921456147 1:215374671-215374693 TAGGGCTGTCTGAAGCTTTGGGG - Intergenic
1063766947 10:9153153-9153175 TAAGAACAACTGAATCTTTGAGG - Intergenic
1068456999 10:57268774-57268796 TAGACTCTTCTGAATCTTTTTGG - Intergenic
1068944701 10:62718091-62718113 TAGGCCCACCTCCAACTTTGGGG + Intergenic
1070526339 10:77298937-77298959 GAGGCCCATCTGATGCTCTGGGG - Intronic
1070769934 10:79076344-79076366 GAGGCCCAGCTGAACCTTGGGGG + Intronic
1073274107 10:102293634-102293656 TAGGCCAATGTGAGTGTTTGTGG + Intronic
1076707968 10:132312217-132312239 TAGGCTGATCTCAAACTTTGGGG + Intronic
1077037844 11:503863-503885 AAGGCCCTTCTGAATCTCTGTGG + Intronic
1077775644 11:5268749-5268771 TAAGCTCATCTGAATTTTTTGGG - Intronic
1082071698 11:47944508-47944530 TACCCCCAGCTGAATCTTGGAGG + Intergenic
1083448921 11:62729317-62729339 CAGACCCATCCGAATCTCTGGGG - Intronic
1087974918 11:104532827-104532849 TGGGCCCATCTGAATAATTGAGG + Intergenic
1088474491 11:110221103-110221125 TAAGCCCTTCTGAATCTCTCTGG + Intronic
1090674917 11:128982998-128983020 TAGGCCCATCTGAATCTTTGTGG - Intronic
1103905899 12:124327072-124327094 TTGGCCCATCTGTCTCCTTGGGG - Intronic
1106317053 13:28603539-28603561 TAGTCCCATGTGAATCGGTGGGG - Intergenic
1108286908 13:48917796-48917818 TAGGCCCACCTGAATCATCCAGG + Intergenic
1108525027 13:51279300-51279322 TAGGCACATCTGAGCCTTTTGGG + Intronic
1114889740 14:26903817-26903839 TAGGACAATCTGAATTTTTAAGG + Intergenic
1115623621 14:35166745-35166767 CTGGCCTATCTGAATCTTTAAGG + Intronic
1117498769 14:56331449-56331471 TTGCAACATCTGAATCTTTGGGG + Intergenic
1121904388 14:97726435-97726457 TAGGCCCCTCTGAACCTAAGTGG + Intergenic
1123824462 15:24067522-24067544 TGGGCCCCTGTTAATCTTTGGGG + Intergenic
1124509417 15:30310354-30310376 TAGGCCCACCTGGATTTTGGTGG - Intergenic
1124734142 15:32228308-32228330 TAGGCCCACCTGGATTTTGGTGG + Intergenic
1126887037 15:53162236-53162258 TAGCCCTTTCTGGATCTTTGTGG - Intergenic
1128262020 15:66239296-66239318 AACCCCCATCTGAATCTTTGTGG + Intronic
1128674854 15:69600974-69600996 TGGGCTCATATGAAGCTTTGGGG + Intergenic
1129332354 15:74834184-74834206 GAGGCCCATCTGCATCTTCCAGG + Intergenic
1132336358 15:101050879-101050901 TAGGCCCATGTGAACCCTTCTGG + Intronic
1138199284 16:55077179-55077201 CAAGCCCATCTGCTTCTTTGGGG - Intergenic
1143560255 17:7689483-7689505 TAAGCCCCCCTGAATCCTTGAGG - Intronic
1150110746 17:62497136-62497158 TAGTCCCATCTGCATCTGTCCGG + Intronic
1156638979 18:39066985-39067007 TATGCCCATCTGGATCTTCCTGG - Intergenic
1159860705 18:73645996-73646018 TAGGTCCAACTCAATTTTTGGGG - Intergenic
1160467865 18:79097265-79097287 TAGGCCCATATCTATCTTTTGGG - Intronic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
925521349 2:4749260-4749282 CAGGAGAATCTGAATCTTTGCGG - Intergenic
931061417 2:58533677-58533699 TAGGACCACCTGAGTCTTTCTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
938218961 2:129549161-129549183 TAGGACCACAGGAATCTTTGTGG + Intergenic
938988505 2:136603653-136603675 TAGGTTAATCTGAATATTTGGGG - Intergenic
940936957 2:159506563-159506585 TGGGCCGATCTGGTTCTTTGCGG - Intronic
940987797 2:160065738-160065760 GAGGCCCATCTCAAATTTTGGGG - Intergenic
941381317 2:164796128-164796150 TTGTGCCATCTGAATCTTTCTGG - Intronic
943384111 2:187181397-187181419 TAGGCCTATTTGAATTTTGGAGG - Intergenic
943667810 2:190628560-190628582 TGGGCCCATCAGAATCTCTCTGG + Intergenic
944453117 2:199863871-199863893 TGGAGACATCTGAATCTTTGAGG - Intergenic
945650941 2:212558464-212558486 TAGGCCAATCTGAAATTTTAAGG - Intergenic
1171261933 20:23741873-23741895 TAAGACCATCTGAAGCTTGGTGG - Intergenic
1174183495 20:48689607-48689629 GAGGCCGATCAGTATCTTTGTGG - Intronic
1178179974 21:30148633-30148655 GAGGACCAGCTGAATCTTTGAGG + Intergenic
1179280649 21:39931156-39931178 GAGGCACATCACAATCTTTGAGG - Intergenic
1180254069 21:46610572-46610594 TAGGCTCATCTGCATCATAGTGG - Intergenic
1185184390 22:49388935-49388957 TAAGTCTTTCTGAATCTTTGTGG + Intergenic
954436217 3:50497724-50497746 CAGGGCCATCTCAATCTCTGTGG + Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
956818252 3:72928707-72928729 AAGGACCATTTGAATTTTTGAGG - Intronic
964197659 3:154082933-154082955 TACTCCCAGCTGAATCTTTATGG + Intergenic
966578603 3:181533179-181533201 AAGGCAGATCTGAATCTTCGGGG - Intergenic
968795079 4:2697990-2698012 GAGGCCCAGCTGAACCTTAGAGG + Intronic
969905156 4:10386944-10386966 TAGGCCCGTCGGATACTTTGTGG + Intergenic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
970191766 4:13524536-13524558 TAGGCTTCTCTGAATATTTGTGG - Intergenic
971317928 4:25582909-25582931 TAGGCCCATCACAAGCTGTGTGG - Intergenic
979465117 4:121028088-121028110 TAGGCTCATCAGTATCTTTGTGG - Intergenic
979624788 4:122832225-122832247 AAGGCAAATCTGTATCTTTGGGG + Intronic
981242693 4:142497115-142497137 AAGCCACATCTGAATGTTTGTGG + Intronic
982062967 4:151623295-151623317 TAGGACACACTGAATCTTTGGGG + Intronic
982334561 4:154219501-154219523 AAGGGCCATCTGGATTTTTGTGG - Intergenic
988346292 5:30041899-30041921 CAGGCACTTCTGAATCTGTGGGG - Intergenic
991581611 5:68161434-68161456 AAGGCCCATCTGGTTCTTTGTGG - Intergenic
993157916 5:84250885-84250907 TAGACACATCTCTATCTTTGTGG + Intronic
993852170 5:93023929-93023951 TATGCCCTTCTAAATATTTGTGG - Intergenic
1003822080 6:9909813-9909835 TAGGCTGATATGAATCTTGGCGG + Intronic
1004067389 6:12262107-12262129 TAGGCCTATCAGCATTTTTGAGG + Intergenic
1008375677 6:50788290-50788312 TACTCCCATCTAAATCCTTGAGG + Intergenic
1011214953 6:84995662-84995684 TAGGCCAGTTTGAATCTGTGAGG - Intergenic
1018356913 6:163027633-163027655 CAGGCCCCTCTGTATCTGTGGGG - Intronic
1018392078 6:163348241-163348263 TAGGCCCACCTGAATCATCCAGG - Intergenic
1025196240 7:56936483-56936505 TTGGCCCATCTTAAGCTTTTTGG + Intergenic
1025675707 7:63640449-63640471 TTGGCCCATCTTAAGCTTTTTGG - Intergenic
1027513001 7:79107125-79107147 TGGGCCCACCTGGATATTTGAGG - Intronic
1030373192 7:108723981-108724003 TAGGCACGACTGATTCTTTGGGG + Intergenic
1031464357 7:122090363-122090385 CAGGCAAATCAGAATCTTTGGGG + Intronic
1032588713 7:133172578-133172600 CAGACCCATTTAAATCTTTGAGG + Intergenic
1044202346 8:89452169-89452191 TGGGCCTATCTGAATTTTGGAGG + Intergenic
1045438234 8:102185799-102185821 TAGGCTCTTCTGAAGATTTGGGG + Intergenic
1046005075 8:108469778-108469800 TAGGCCCTTATGATTCCTTGGGG - Intronic
1047213233 8:122856702-122856724 TAGGGCGATCTGATTCGTTGAGG - Intronic
1047984813 8:130221606-130221628 TAGGCCTAGCTGCTTCTTTGGGG + Intronic
1050635148 9:7604563-7604585 TAGGCCCATCTGCATAATTCAGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053345940 9:37378305-37378327 TAGTTCCTTCTGAATCTTTTCGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055357075 9:75448593-75448615 CAGGCCCCACTGAATCTTGGAGG - Intergenic
1059137572 9:111821740-111821762 TAGGCTCAGCAGAACCTTTGTGG - Intergenic
1060002132 9:119968465-119968487 TAGACCCACCTGAATAATTGAGG - Intergenic
1061341034 9:129981509-129981531 TAGGCACATCTGTAGATTTGGGG - Intronic
1187925582 X:24247039-24247061 TAACCTCATCTGAATCTCTGTGG + Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1195927636 X:110041877-110041899 AAGGCACAGCGGAATCTTTGGGG - Intronic
1198274498 X:135088277-135088299 TTGGTCCTTCTGAATCTCTGAGG + Intergenic
1200072663 X:153536783-153536805 CAGCCCCATCTGTATATTTGGGG + Intronic