ID: 1090675174

View in Genome Browser
Species Human (GRCh38)
Location 11:128985678-128985700
Sequence ATGAATGAATGGATGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2076
Summary {0: 1, 1: 3, 2: 45, 3: 360, 4: 1667}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090675174_1090675177 -2 Left 1090675174 11:128985678-128985700 CCTTTGTCCATCCATTCATTCAT 0: 1
1: 3
2: 45
3: 360
4: 1667
Right 1090675177 11:128985699-128985721 ATTCAACCTTTAAGTACCTATGG 0: 1
1: 0
2: 0
3: 9
4: 109
1090675174_1090675181 25 Left 1090675174 11:128985678-128985700 CCTTTGTCCATCCATTCATTCAT 0: 1
1: 3
2: 45
3: 360
4: 1667
Right 1090675181 11:128985726-128985748 CTAAACAGTGTGCCAGGCCCTGG 0: 1
1: 0
2: 1
3: 34
4: 294
1090675174_1090675182 26 Left 1090675174 11:128985678-128985700 CCTTTGTCCATCCATTCATTCAT 0: 1
1: 3
2: 45
3: 360
4: 1667
Right 1090675182 11:128985727-128985749 TAAACAGTGTGCCAGGCCCTGGG 0: 1
1: 0
2: 5
3: 44
4: 368
1090675174_1090675180 19 Left 1090675174 11:128985678-128985700 CCTTTGTCCATCCATTCATTCAT 0: 1
1: 3
2: 45
3: 360
4: 1667
Right 1090675180 11:128985720-128985742 GGAATGCTAAACAGTGTGCCAGG 0: 1
1: 0
2: 2
3: 18
4: 154
1090675174_1090675183 27 Left 1090675174 11:128985678-128985700 CCTTTGTCCATCCATTCATTCAT 0: 1
1: 3
2: 45
3: 360
4: 1667
Right 1090675183 11:128985728-128985750 AAACAGTGTGCCAGGCCCTGGGG 0: 1
1: 0
2: 13
3: 88
4: 839

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090675174 Original CRISPR ATGAATGAATGGATGGACAA AGG (reversed) Intronic
Too many off-targets to display for this crispr