ID: 1090675211

View in Genome Browser
Species Human (GRCh38)
Location 11:128986053-128986075
Sequence CAGCAGCAACAGATGAAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 429}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090675211 Original CRISPR CAGCAGCAACAGATGAAGAA AGG (reversed) Exonic
900419857 1:2551417-2551439 CAGCAGCAACAGGCCCAGAAGGG - Intergenic
900469730 1:2847838-2847860 CCGCAGCCACAGAAGAAGACGGG - Intergenic
904797857 1:33070958-33070980 CAGCAGCAGCAGCTGGAGAAAGG + Intronic
905970112 1:42135351-42135373 CACCAGCAGCAGAGGAAGAAAGG - Intergenic
906114966 1:43350338-43350360 AAGAAGCAGCAGATGAAGGATGG - Intronic
906296969 1:44654871-44654893 CAGCAGCAACAGGCGCAGCATGG + Exonic
909293130 1:73910231-73910253 CAACAGCACCATATGAAAAATGG + Intergenic
909295495 1:73942571-73942593 AAGCAGTAAAAGTTGAAGAAAGG - Intergenic
909554480 1:76938250-76938272 GAGCAGCAAAGGGTGAAGAAAGG + Intronic
910682909 1:89885666-89885688 CACCAGCAACAGTAGAATAAGGG - Intronic
912410040 1:109474814-109474836 CAGCATCAACAGATGACAAAGGG + Intronic
912484207 1:110011719-110011741 CAGAAGCAGCTGATGAGGAAGGG + Intronic
912532358 1:110335386-110335408 CAACAGCAACAGCAAAAGAAGGG + Intergenic
912788633 1:112628983-112629005 CAGGAGCAACAGCAGAAGCAGGG - Intronic
913129573 1:115827638-115827660 CAGCAGCAACAGCTGGATAATGG + Intergenic
914929306 1:151916196-151916218 CAGCAGCCAGAGGTGAAGAAAGG + Intergenic
915085610 1:153386612-153386634 CAGCTGCAAAAGAAGAACAAGGG - Intergenic
916875127 1:168960970-168960992 CATCAGCAAAACTTGAAGAATGG + Intergenic
917649867 1:177065705-177065727 CAGCAGCAAAAAATGCAGATTGG + Intronic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
921104270 1:211959964-211959986 CAGCAGCAACAGCAGCATAACGG - Intronic
921501361 1:215907569-215907591 CAGCAGCATCACTTGAAGAAAGG - Intronic
921903132 1:220468814-220468836 CAGCAGCAGCATTTGCAGAAAGG + Intergenic
921922460 1:220685131-220685153 CAGCATAAACAGTTGAAGCATGG - Intergenic
922245089 1:223788112-223788134 CAGCTGAGAGAGATGAAGAAGGG + Intronic
922525838 1:226302811-226302833 GAGAAGCAACAGATAAAGTATGG + Intronic
924045211 1:240022226-240022248 CAGAAGCAAAAATTGAAGAATGG + Intronic
1063027777 10:2199493-2199515 CATCATGAACAGATGAATAAAGG + Intergenic
1063145559 10:3291987-3292009 CAGCTGCAAAAGAGGAAGAATGG + Intergenic
1063206899 10:3840930-3840952 TAGGAGCAACAGCTGAATAATGG + Intergenic
1065871464 10:29959759-29959781 CGGCTGCAGCAGATGAAGACTGG + Intergenic
1067017451 10:42768793-42768815 CAGCAACAACAGCAGCAGAAAGG - Intergenic
1070162182 10:73873469-73873491 CAGCAGGAACAGTTGAAGGTCGG + Intronic
1070696564 10:78568297-78568319 CAGAAGCAAGAGAAGAGGAAGGG - Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071366810 10:84908305-84908327 CAGCTTCAAGAGATGAAGAAAGG + Intergenic
1072642703 10:97224523-97224545 CAGCAGCAAAAGCAGCAGAAAGG + Exonic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1074393073 10:113073984-113074006 CAGCAGCACCGGATGTGGAATGG - Intronic
1074425816 10:113350296-113350318 CAACTCCAACAGCTGAAGAAGGG - Intergenic
1076121552 10:127940553-127940575 CAGCAACACCTGATGAAGGAAGG - Intronic
1076571203 10:131434358-131434380 TAGAAGCAAGATATGAAGAATGG + Intergenic
1076610305 10:131722231-131722253 CAGCGGCCACAGATGCAGAGAGG + Intergenic
1076718064 10:132377300-132377322 AAGCAGCAAAAGAAGAATAAAGG - Exonic
1078889851 11:15544695-15544717 CACCAGCAGCAGATGAACAGCGG - Intergenic
1079466219 11:20733472-20733494 AAGCAGGAACAGATGAGGATAGG + Intronic
1080190108 11:29534938-29534960 CAGCAGCATCTGAGGAAGAGGGG - Intergenic
1080456754 11:32426366-32426388 GAGCAGCTACACAAGAAGAATGG + Intronic
1080682245 11:34487668-34487690 CAGCAGCATCAGCAGAAGGAGGG - Intronic
1081330788 11:41797210-41797232 CAGCAGCAACCAATGAACTATGG + Intergenic
1082869644 11:57932153-57932175 CAGAAGCAACAGATGAAAAAAGG - Intergenic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084955234 11:72687733-72687755 CCCCAGCTACAGAGGAAGAAGGG + Exonic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085908792 11:80797449-80797471 AAGCAGCAAAAGAAGAAGGAAGG - Intergenic
1086017689 11:82186794-82186816 CAGAAGCAATAGTTGAAGAATGG + Intergenic
1086409001 11:86525358-86525380 CAACAGCAAGAGAGGAAGAAAGG + Intronic
1087359477 11:97139915-97139937 GAACAGCAGGAGATGAAGAAAGG - Intergenic
1087530987 11:99381925-99381947 GAGGAGCATCAGATGAAGATGGG - Intronic
1089330292 11:117684788-117684810 CCCCAGCAATATATGAAGAAAGG - Intronic
1089800861 11:121025249-121025271 CAGCAGCATGACATGAACAAGGG - Intronic
1090493461 11:127187371-127187393 CAGAGGCAACAGATGATGAAAGG - Intergenic
1090675211 11:128986053-128986075 CAGCAGCAACAGATGAAGAAAGG - Exonic
1090803515 11:130188858-130188880 CAGCAGCTTCAGCTGAGGAAGGG - Exonic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092967650 12:13660003-13660025 GAGTAGCAACAGATGAGGACTGG - Intronic
1093138997 12:15485664-15485686 CAGCTGCAACTGATGAGGAATGG - Intronic
1093747829 12:22762993-22763015 CAGCATCAACAGATTAAGACAGG + Intergenic
1094740563 12:33283489-33283511 CAGCAGCAAAACATCAAAAATGG + Intergenic
1095373776 12:41502062-41502084 CAACAGCAAAAAAAGAAGAAAGG - Intronic
1095945190 12:47749644-47749666 CAGCAGCAGTAGATCAACAAAGG + Intronic
1096111728 12:49032778-49032800 CAGCAGCAACAGCAGCAGATGGG - Exonic
1096919386 12:55067917-55067939 CAGCAGCAACAGTTTGAGGAAGG + Intergenic
1097189348 12:57212130-57212152 CAGCACCAACGGATGACCAACGG + Exonic
1097413383 12:59283221-59283243 CAGCAGCCACAGGGGAAGAGTGG - Intergenic
1097585481 12:61510695-61510717 CAGCAGCAGCAGGAGAAGAATGG + Intergenic
1097743852 12:63277399-63277421 CAGCAGAAATAGGTGAAGATAGG + Intergenic
1099988200 12:89693942-89693964 AAGCAGAAATAGAAGAAGAATGG - Intronic
1100052063 12:90460924-90460946 CAGGAGCAAGAGAGGAAGGAGGG + Intergenic
1100513307 12:95299149-95299171 CAGCAACAACAGAAAAAAAATGG - Intronic
1100607279 12:96162111-96162133 CATAAGCACCAGATGGAGAAGGG - Intergenic
1101341863 12:103849197-103849219 CTGTAGTAAAAGATGAAGAATGG - Intergenic
1101647639 12:106645915-106645937 CCTCAGCTACAGATGGAGAAAGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1102316289 12:111890478-111890500 AAGAAGCAACAGATGCTGAAGGG + Intronic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1102573292 12:113840687-113840709 CAGCAGCAAAGCAGGAAGAAGGG - Intronic
1102791316 12:115648344-115648366 GAGCAGCAAGAGAAGAAGCAAGG + Intergenic
1102942931 12:116960135-116960157 CAGCAAGAACAGATAACGAATGG - Intronic
1104134459 12:125923990-125924012 CAGAAGCAACAGAGCAAGAGAGG - Intergenic
1104756114 12:131270331-131270353 CAGCATCATCAGATGAAGGCAGG + Intergenic
1104777662 12:131400694-131400716 CAGCATCATCAGATGAAGGCAGG - Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1106401919 13:29439393-29439415 CAGCATCAATAGATGAAAAAAGG - Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1108364517 13:49696588-49696610 CAGATGCATAAGATGAAGAAAGG - Intergenic
1108547919 13:51514990-51515012 CAGCAGCAAAGGCTGCAGAACGG + Intergenic
1108552942 13:51564708-51564730 CACATGCTACAGATGAAGAAAGG + Intergenic
1108956002 13:56157748-56157770 AAGCAACAAGAGAGGAAGAAAGG + Intergenic
1109452813 13:62540399-62540421 CACCAGCAACAGACAATGAAAGG + Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1110804156 13:79735793-79735815 CTGCAGCAACAGTGGAAGAAGGG + Intergenic
1111613870 13:90640072-90640094 AAGGAGAAAGAGATGAAGAAAGG - Intergenic
1114196058 14:20477227-20477249 GGGCAGCAAAGGATGAAGAAGGG + Intergenic
1115009876 14:28532878-28532900 CAATAGCAACCAATGAAGAAAGG - Intergenic
1116931093 14:50691789-50691811 CAACAACAACAGATAAAGATGGG - Intergenic
1117249162 14:53918206-53918228 CAGCACAAACAGATTAAGACAGG - Intergenic
1117848441 14:59939302-59939324 GAGAAGTAACAGATGAAGACAGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1120924466 14:89783797-89783819 AAGCAGCAACAGATTAATAATGG - Intergenic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG + Intergenic
1121805930 14:96822841-96822863 CAGGAGCAAGAGATCAAGTAGGG - Intronic
1122215089 14:100198025-100198047 CAGCAGCAACAGGAGAATCAAGG + Intergenic
1122977835 14:105178252-105178274 CACCAGGAGCAGATGAGGAAGGG + Intronic
1124237336 15:28002174-28002196 CAGTAGCAAAACATGAAGTAGGG + Intronic
1128177922 15:65573058-65573080 CAGCAGCAAGGAAGGAAGAAGGG + Intronic
1128532972 15:68467535-68467557 CAGGAGCCACAGCTGAAAAAAGG - Intergenic
1129461167 15:75700697-75700719 CAGCAGAAACTGCTGAAGACAGG + Intronic
1130243765 15:82223543-82223565 CATCAGCAAGAAATGAAGGATGG + Intronic
1130840372 15:87694274-87694296 CAACACAAACAGATGAAGAGTGG + Intergenic
1134071158 16:11260596-11260618 TAGCAGGCACAGGTGAAGAAAGG + Intronic
1134275669 16:12773997-12774019 CAGCAGCAACAGATGACAGCAGG + Intronic
1135994928 16:27240552-27240574 CAGCAGGAGCAGCTGAGGAAAGG + Intronic
1136285194 16:29236583-29236605 CAGCAGCGCCAGAGGCAGAAGGG + Intergenic
1137440969 16:48498267-48498289 CAGCAGAACCAGCTCAAGAAAGG + Intergenic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1137694581 16:50453018-50453040 GAGAAGCAGCAGAAGAAGAAAGG + Intergenic
1139192311 16:64879056-64879078 CAGCAGGAACAGAGGGAAAAAGG - Intergenic
1139651429 16:68364023-68364045 AAGCAGCGACAAATGAAGCACGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1141593269 16:85082532-85082554 CAGCAGAAACAGGTAAACAAAGG - Intronic
1142879519 17:2873510-2873532 AAGCAGCAGCAGCTGCAGAAAGG + Intronic
1143628458 17:8123874-8123896 AAGCTGCAAAATATGAAGAAGGG - Intronic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1143790035 17:9287427-9287449 CAACAGGCACAGAAGAAGAAAGG + Intronic
1146787787 17:35733701-35733723 CATCACCAACAAAAGAAGAAAGG + Intronic
1146802169 17:35834028-35834050 CAGCCTCAACAGAGTAAGAAAGG - Intronic
1147504849 17:41005817-41005839 CATCACTAACAGGTGAAGAAAGG - Intergenic
1147881747 17:43658883-43658905 CACCAGCAGCAGATGAGGCAGGG - Intronic
1148172531 17:45534681-45534703 GAGCAACAACAGAAGAAGCAAGG + Intergenic
1148276739 17:46310769-46310791 GAGCAACAACAGAAGAAGCAAGG - Intronic
1148298856 17:46528357-46528379 GAGCAACAACAGAAGAAGCAAGG - Intronic
1148980147 17:51566656-51566678 CATGGGCACCAGATGAAGAAGGG + Intergenic
1150113536 17:62523638-62523660 CAGCATTAACTGATGAAGATGGG - Intronic
1150403735 17:64881606-64881628 GAGCAACAACAGAAGAAGCAAGG + Intronic
1150509920 17:65739817-65739839 AAGAAACAACAGATGAAGTAAGG - Intronic
1151837166 17:76589507-76589529 CTGAAGCAAGAGCTGAAGAATGG - Intergenic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1153478919 18:5527704-5527726 AAGCGGCAAAGGATGAAGAAAGG + Intronic
1153742006 18:8138870-8138892 GAGCAGCCAGAGAGGAAGAAAGG - Intronic
1155060772 18:22226591-22226613 CAGCAGTAGCAAATGAAGACAGG + Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157980951 18:52379867-52379889 CAGCACAAACAGATTAAGACAGG - Intronic
1159157570 18:64604313-64604335 CTGCAACAACAGACAAAGAAAGG + Intergenic
1159263471 18:66047540-66047562 CAGTAGCAACACAAAAAGAATGG - Intergenic
1159846733 18:73470028-73470050 CAAAAGCAAGAAATGAAGAAAGG - Intergenic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160167976 18:76530523-76530545 CAGGAGCCACACCTGAAGAATGG + Intergenic
1160625727 18:80203622-80203644 CAGCAACCACAGATGAGGCAAGG - Intronic
1161661156 19:5547088-5547110 CAGCGGCAACAGATTGTGAAGGG + Intergenic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1162565501 19:11444097-11444119 CACCAAAAACAAATGAAGAAGGG - Intronic
1164146312 19:22514628-22514650 CAGCTGCAACAGAGAAAGAAGGG + Intronic
1164160040 19:22620430-22620452 CAGCTGCAACAGAGAAAGAAGGG - Intergenic
1164259119 19:23553904-23553926 GAGGAGCCACAGAGGAAGAAGGG - Intronic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165798872 19:38535712-38535734 CGGCAGCAAGAGGTGAATAAAGG - Intronic
1167528105 19:49997953-49997975 CAGCTGGAACAGAAGAGGAAAGG - Intronic
1168373754 19:55858444-55858466 CTGAAGCAAGAGATGCAGAAAGG + Exonic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
927570989 2:24159891-24159913 CAGCAGCCACAGAGAAAGGACGG - Intronic
928941350 2:36730507-36730529 CAGTAGGAAGGGATGAAGAAGGG + Intronic
929020826 2:37551033-37551055 CAGCATCAAAAGTTGCAGAATGG + Intergenic
929138376 2:38646081-38646103 CAACAGGAACAGAAGAAGCAGGG - Intergenic
929483349 2:42333831-42333853 CAGCAGCCACAGAAACAGAATGG + Intronic
932086897 2:68770506-68770528 CAGCGGCAGAAGATGAAGAAAGG + Intronic
932156279 2:69420781-69420803 CAACAAAAAGAGATGAAGAAAGG + Intronic
933284169 2:80366671-80366693 CAACAGCAGCGGAGGAAGAAGGG - Intronic
933527396 2:83459527-83459549 CAGCATCCACAGATTAATAATGG + Intergenic
933784865 2:85830514-85830536 CATCGGCAAAAGATGGAGAAGGG + Intergenic
935195281 2:100810268-100810290 AAGAAGCAAAAGAAGAAGAAGGG + Intergenic
935312674 2:101801074-101801096 CAGCAGCAGCAGCTGGGGAAAGG - Intronic
935536078 2:104296184-104296206 CAGCTGCAGAAGATGAAAAAAGG - Intergenic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
937688863 2:124731022-124731044 AGGCAGCAACATAAGAAGAATGG - Intronic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
941886305 2:170531072-170531094 CAGCAGACACAGATCCAGAAAGG - Intronic
944314470 2:198270067-198270089 CAGCAGCATCAGATGATCTAGGG + Intronic
944759687 2:202801701-202801723 AAGCAGCAAGCGAAGAAGAAAGG + Intronic
945239433 2:207662586-207662608 CAGCAGAAACAGACTAAGATGGG + Intergenic
945460393 2:210101066-210101088 CAGAAGTAAAAGATGCAGAAAGG - Intronic
945500877 2:210573357-210573379 CACCAGCAACAGAGGATGGATGG - Exonic
946057817 2:216917065-216917087 CAGAAGCAACCCATGAGGAATGG - Intergenic
947219222 2:227777199-227777221 CAGCAGGAACAGACTAAGACAGG - Intergenic
948081940 2:235213920-235213942 CAGGAGGAGCAAATGAAGAAGGG - Intergenic
948548393 2:238749463-238749485 CAGCAGAGACAGAGGAAGAGTGG + Intergenic
948704579 2:239780891-239780913 CAGAACCAAGAGATGAAGAGGGG - Intronic
1169734343 20:8821894-8821916 CAGCAGAAACAGGAGAAGCATGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170013328 20:11752138-11752160 CTGCAGCAACAGGGGAAGACAGG - Intergenic
1170287091 20:14721647-14721669 CAGAAGAAACCTATGAAGAAAGG - Intronic
1170393712 20:15903415-15903437 CAGCAGCAACAGAGAGTGAAGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1173073242 20:39790499-39790521 CAGGAAGAACAGAGGAAGAAGGG + Intergenic
1173098266 20:40059370-40059392 CAGCAGCAAGAGAGAGAGAAAGG - Intergenic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1174029162 20:47607484-47607506 CAGCTGAAACAAATAAAGAAGGG - Intronic
1175364690 20:58444585-58444607 CAGCACCAACAGGCGAGGAAGGG - Exonic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1175819476 20:61900827-61900849 AGGCAGGAACAGATGAGGAAAGG - Intronic
1176992259 21:15511477-15511499 TAGAAGAAACAGATGAAAAATGG - Intergenic
1177035912 21:16042505-16042527 AAGCAACCACAGATTAAGAATGG - Intergenic
1177081873 21:16649678-16649700 GAGCAGGGACAGATGATGAAGGG + Intergenic
1178114068 21:29398944-29398966 CAGCAGCAACTAAGGAGGAAAGG - Intronic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178281956 21:31291438-31291460 CAGCAGGATCAGATGCAGATGGG - Intronic
1178320595 21:31602255-31602277 CAGCAGCAGCAGAAGAAAACTGG + Intergenic
1179091925 21:38274241-38274263 AGGCAACAAGAGATGAAGAAAGG - Intronic
1181374653 22:22447334-22447356 CAGCAGGAACAGCAGAAAAAAGG + Intergenic
1182043829 22:27259126-27259148 AAGCAGCAACAGAGAGAGAAGGG - Intergenic
1182754597 22:32668577-32668599 CAACAACAACAAAGGAAGAAGGG - Intronic
1183063219 22:35347858-35347880 CAGAAGGAACAGAGGAAGGATGG - Exonic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183601134 22:38841262-38841284 CAGCAGCCACAGACAGAGAAGGG - Intronic
1183969087 22:41462734-41462756 CAGCTGCAAAAGAAGAAGACTGG + Intronic
1184101830 22:42344838-42344860 GAGCAGCAACCGAAGAAGAAAGG + Intergenic
1184208759 22:43023061-43023083 CAGCAGCACCCCATGAAGCAGGG - Intergenic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
950024532 3:9811070-9811092 CAGCAGCCAAAGAGGGAGAAAGG - Intronic
950024839 3:9813127-9813149 CAGGAGCAACAGCTGTGGAAAGG - Intronic
950215598 3:11156075-11156097 CAGCAGCAAAGGATGAATAGAGG + Intronic
951164145 3:19464566-19464588 CAGCAGTAACAGAATAAAAAGGG + Intronic
951274215 3:20665448-20665470 AAGAAGGAACAGAAGAAGAATGG - Intergenic
953050777 3:39340971-39340993 CAGGAGCAACAGATACAGAAGGG + Intergenic
953652116 3:44816206-44816228 CAGCAGCAGCAGATAAATATGGG - Intronic
956609145 3:71104395-71104417 CAGCAGCAACAGCAGCAGAAGGG - Intronic
958150754 3:89691119-89691141 CAGCAGAAACAGCAAAAGAATGG - Intergenic
960611890 3:119562373-119562395 CAGCAGGAAGAGATGACGAGAGG + Intergenic
960615067 3:119589008-119589030 GAGCATCAAGAAATGAAGAAAGG - Exonic
961269139 3:125675182-125675204 CAGCAGCTACAGGTGATGCAAGG - Intergenic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962182377 3:133221584-133221606 AGGCAGCAAGAGAGGAAGAAAGG - Intronic
962865869 3:139447721-139447743 CACCAGCAAGAGATGAAAAGAGG - Intergenic
964173062 3:153793742-153793764 CAGGAGGAAGAGATAAAGAAGGG - Intergenic
965466037 3:169031754-169031776 CAGCAGCCACTGATGATGCAGGG - Intergenic
965664540 3:171078913-171078935 CTGCTGCAACAGAAGATGAAAGG - Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966800192 3:183756358-183756380 GAGCAGCAACAGAGGTACAAAGG - Intronic
967513436 3:190339164-190339186 GAGCAGGAAAAGATGAAGGATGG - Intronic
967936838 3:194735449-194735471 AGACAGCAACAGAAGAAGAAAGG - Intergenic
968871891 4:3246576-3246598 CAGCAGCACCTGAGGGAGAAGGG - Intronic
969134118 4:5016332-5016354 CAGCAGAAACAGACTAAGACAGG + Intronic
969676555 4:8617631-8617653 CAGCAGCAACAGATTCTCAAGGG - Intronic
969981923 4:11166468-11166490 CAGCAGCTACATCTGAAGGAGGG + Intergenic
970416987 4:15868448-15868470 GAGCAGCAAGAGATTAAAAAAGG + Intergenic
970740961 4:19237112-19237134 CTCCAGCAACAACTGAAGAATGG + Intergenic
971384095 4:26127271-26127293 CAGCAGCAACGGAAGCTGAAAGG - Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972457173 4:39265891-39265913 CTCTAGCAACAAATGAAGAAAGG + Intronic
973580120 4:52335253-52335275 CAGCAGCAACCACTGAAAAACGG + Intergenic
974274651 4:59702761-59702783 CAGCAACAACAGAAGACAAAGGG + Intergenic
974499318 4:62678158-62678180 CATCAACAACACATAAAGAAAGG - Intergenic
975033022 4:69647059-69647081 CAGCAGGAACATAGGAAGGAGGG + Exonic
975109575 4:70608594-70608616 CAGCAGCAACAGTGGAAGAATGG + Intergenic
975835203 4:78415577-78415599 GAGGAGCAACAGGTGAAAAAAGG + Intronic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976040852 4:80883355-80883377 AAACAGCAAGAGAAGAAGAAAGG + Intronic
976118447 4:81753898-81753920 CAGCACAAACAGACTAAGAAAGG - Intronic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
976994589 4:91414479-91414501 AGGCAGCAAGAGAGGAAGAAAGG + Intronic
977087905 4:92628306-92628328 CAGCAGTAAAAGATTAAGAAGGG + Intronic
977197109 4:94076985-94077007 CAGAAGCTACAGGTCAAGAATGG - Intergenic
977369821 4:96121411-96121433 CAGAAGCAACATAGGAAGGAGGG + Intergenic
978441883 4:108741800-108741822 CAGCAGCAGTAGCTGAAGCAGGG - Intergenic
978696151 4:111583034-111583056 TAGCAGAAAGAGATGATGAAGGG - Intergenic
978892681 4:113848758-113848780 CACCTGCAACAGAGAAAGAAAGG - Intergenic
979749168 4:124255775-124255797 CAGCTGGAACTGATGAAGACAGG - Intergenic
979889951 4:126079045-126079067 CAGCAGAAACATATTAAAAATGG - Intergenic
980204279 4:129697686-129697708 CAGTAGCAAGGGATGGAGAACGG + Intergenic
981079098 4:140620887-140620909 CAGCAGCAATAGCTAAAAAAAGG + Exonic
981667315 4:147244541-147244563 CAGCAGAAACATTTGAATAATGG - Intergenic
982216593 4:153087674-153087696 CAGCAGGAAGAGATGAAGCGGGG + Intergenic
983031711 4:162811126-162811148 CAGGAGCAAGAGAGAAAGAATGG + Intergenic
983979029 4:173972033-173972055 AGACAGCAAGAGATGAAGAAAGG - Intergenic
984768538 4:183418562-183418584 CAGCAGGAACAGACCAAGACAGG - Intergenic
985336250 4:188898622-188898644 CACAAGCAACTGATGAAGCAGGG - Intergenic
985353775 4:189095771-189095793 CAGCAGAAAATGATGAAGAGGGG + Intergenic
986048783 5:4067337-4067359 CAGCAGCCCCAGAAGAAAAATGG + Intergenic
986107547 5:4674226-4674248 CAGCAGCAACACATAAATACAGG + Intergenic
986162432 5:5242036-5242058 CAGCAGCTACAAAATAAGAAAGG - Exonic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
988133866 5:27142595-27142617 CACCAGCAATGGATGAGGAAAGG + Intergenic
988544722 5:32144731-32144753 CAGCATCCACAGTGGAAGAACGG + Intronic
989026815 5:37077391-37077413 CAGCAGCAACAGACGTAACAGGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990236508 5:53773735-53773757 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
991218622 5:64185855-64185877 CATAAGTAACAGATGAACAAAGG + Intronic
991449678 5:66738619-66738641 TAGCAGGAGCAGGTGAAGAATGG + Intronic
992678218 5:79126990-79127012 GAGGAGCCACAGAGGAAGAAAGG + Intronic
992798622 5:80275600-80275622 CAGCATCAAAACTTGAAGAATGG + Intergenic
993857004 5:93088664-93088686 CAGCTGCAACAAAAGAAAAAAGG - Intergenic
994492672 5:100466873-100466895 AAACAACAAGAGATGAAGAAAGG - Intergenic
994653747 5:102562785-102562807 CAGCAGAAACAGATTAATAGAGG + Intergenic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996067477 5:119095261-119095283 CAGCAGCAGCAAAAGAACAAGGG + Intronic
996861665 5:128073966-128073988 AAGAAGAAACAGATGCAGAAAGG + Intergenic
997419705 5:133756298-133756320 CAGTAGCAGAAGATGCAGAAGGG + Intergenic
997489982 5:134266451-134266473 AAGCAGTAACAGAGAAAGAAAGG + Intergenic
997729457 5:136156595-136156617 CTGAAGGAACTGATGAAGAAAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
999912035 5:156212076-156212098 AGCCAGCAACAGAAGAAGAAAGG + Intronic
1000046517 5:157526255-157526277 CAGTAATAACAGATGGAGAATGG + Intronic
1000108717 5:158086412-158086434 CAGCAGGGATAGATGAACAAAGG - Intergenic
1000324928 5:160165033-160165055 CAGCAGCAAGAGGAAAAGAAGGG - Intergenic
1000637591 5:163661562-163661584 CAGCAACAGCAGATGAACTATGG + Intergenic
1001644359 5:173269223-173269245 CAGCAGCAACAGGCGAAGGCTGG + Intergenic
1001742324 5:174064259-174064281 CAGCCGGAACAGAAGAACAAAGG + Exonic
1002976970 6:2089466-2089488 CAGCTACAAAAGTTGAAGAAGGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003136013 6:3435298-3435320 CAGGAGGAAGAGATGAGGAAGGG - Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1003784810 6:9473591-9473613 CAGCAGCAACAAATGACAAATGG + Intergenic
1004698089 6:18052630-18052652 GAGCAGGAAGAGAGGAAGAAAGG - Intergenic
1004755629 6:18607731-18607753 AAGGAGCAAGAGAGGAAGAAGGG + Intergenic
1005290583 6:24375073-24375095 AAGCTGCAGCAGATGAAGAGTGG - Intergenic
1005529957 6:26693269-26693291 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
1005540839 6:26808378-26808400 AAACAGCAAGAGAGGAAGAAAGG - Intergenic
1005814213 6:29537908-29537930 CAGCAGCAACAGAAGGTCAAAGG + Intergenic
1006059981 6:31412362-31412384 CAGCAGCAACAGCAGAAACATGG - Exonic
1007003900 6:38341846-38341868 CAGCAGCAAAGGTGGAAGAAAGG + Intronic
1007177470 6:39906679-39906701 CAGCAGAACCAGCTCAAGAAAGG - Exonic
1007323610 6:41043941-41043963 CAGCAGCAGCAGGTGCAGCAGGG - Exonic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1010484198 6:76390372-76390394 CAGTAACAACAGAATAAGAATGG - Intergenic
1010909636 6:81537324-81537346 CAGATGGAACAGATGAAGACAGG - Intronic
1011538328 6:88402545-88402567 TAACAGAAACAGAGGAAGAAAGG - Intergenic
1012123819 6:95400869-95400891 CAACAGCAGCAGATGGAGAAGGG - Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013734216 6:113206768-113206790 CACCTAAAACAGATGAAGAAGGG - Intergenic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1014034677 6:116752533-116752555 CATCAGCAACAGTAGAAGATGGG - Exonic
1014110116 6:117611291-117611313 CACCAACAAAGGATGAAGAATGG + Intergenic
1014156420 6:118115223-118115245 CTGCAGCAACAGGAGATGAAGGG + Intronic
1014609940 6:123529934-123529956 CAGCAGAAGCAAATTAAGAAAGG - Intronic
1014699167 6:124662086-124662108 CAGCAGCAGCTGATGGATAATGG + Intronic
1015217566 6:130767696-130767718 CAGCAGCAATGGATGCAAAAGGG - Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1016040756 6:139429784-139429806 CAGCAACAACAGATAGGGAAGGG - Intergenic
1016900095 6:149092638-149092660 CAGCAGCAAGATATCAGGAAAGG - Intergenic
1017492380 6:154955850-154955872 CAACAACAACAAAAGAAGAAAGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018091552 6:160349956-160349978 CAACAGCAACAGCGGCAGAAAGG - Intronic
1018562268 6:165113880-165113902 GAGCAACAAGAGAGGAAGAAAGG - Intergenic
1019056898 6:169230445-169230467 CAGCACTTACAGATTAAGAAAGG + Intronic
1019148613 6:169989348-169989370 CAGCAGTAGCAGCTGAGGAAAGG - Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1020492323 7:8802917-8802939 CAGCATAAACAGACTAAGAATGG - Intergenic
1021115871 7:16745957-16745979 CAGCAGAATCAGAGGAAAAATGG + Intergenic
1021167486 7:17359308-17359330 AAGCATAAACAGATAAAGAAGGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1026808703 7:73444310-73444332 CAGTGGCAGCCGATGAAGAATGG + Intronic
1027670822 7:81095358-81095380 CAGCACCAGCTGAAGAAGAAAGG - Intergenic
1028357699 7:89929366-89929388 CAGCAGGAACACCTGAAAAAAGG - Intergenic
1028625991 7:92877607-92877629 AAACAGCAAGAGAGGAAGAAAGG + Intergenic
1029386585 7:100247500-100247522 CAGCAGCAGCAATTGAAGATGGG - Intronic
1030114303 7:106051428-106051450 CACCAGTAAAAGATGAAGAAGGG - Intergenic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1031111203 7:117611061-117611083 CAGCTCCAACACATGAAGAAAGG - Intronic
1031669692 7:124527949-124527971 CAGGAGCAAGAAAGGAAGAAGGG + Intergenic
1032043235 7:128579401-128579423 CAGCATTAACTGATGAAGATGGG - Intergenic
1032904493 7:136348554-136348576 TAGCAGGAACAGAGGAACAATGG + Intergenic
1033840352 7:145366050-145366072 CAGCAGCAACAAATGTGCAAGGG - Intergenic
1033932362 7:146539887-146539909 CAACAGCAATAGTTGAATAAGGG + Intronic
1034150598 7:148912158-148912180 AAGCTGCAACAGACGAAAAAAGG - Intergenic
1034453140 7:151148602-151148624 CAGCACCAACAAATGGAGCAGGG - Exonic
1034852107 7:154503078-154503100 GAGCAGAAACAGAGGAAGCAAGG - Intronic
1036069449 8:5424507-5424529 CTGCAGGAACATATGAAGTATGG + Intergenic
1036692114 8:10950562-10950584 CAGCAGGTGCAAATGAAGAAAGG + Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037228032 8:16619506-16619528 CAGAAGCAACAGATTAACACTGG - Intergenic
1037992881 8:23333148-23333170 CAGCAGGAGCAGACGATGAAGGG - Intronic
1038610786 8:29058535-29058557 AAGCAGCAAAATATGAAAAAAGG - Intronic
1038713750 8:29973244-29973266 CAGCAGGAACAGATGTGTAAGGG + Intergenic
1038931951 8:32203259-32203281 AACCAGAAACAGAAGAAGAAAGG + Intronic
1039911590 8:41831042-41831064 TTGCAGCAACAGATGATGAAGGG + Intronic
1040470046 8:47729392-47729414 CAGCTGCAACAGCAGAAGCAGGG - Exonic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1041426029 8:57721634-57721656 CAGGAGTAAGAGATGGAGAAGGG + Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041993639 8:64026314-64026336 AAGAAGAAAAAGATGAAGAAAGG - Intergenic
1042047808 8:64673465-64673487 CAGCAGCCACACAAAAAGAAGGG - Intronic
1043031010 8:75133500-75133522 CAGCAGCATCAGAAGCACAAGGG - Intergenic
1043502109 8:80868565-80868587 CAGCATCATCAGATGGCGAATGG + Intronic
1043549246 8:81350619-81350641 AAGCAGCAGCAGATAAACAATGG - Intergenic
1043603819 8:81974561-81974583 AAACAGCAACAGAGGAAGAAAGG - Intergenic
1045561162 8:103264469-103264491 CAGCAGGGAAGGATGAAGAATGG + Intergenic
1045843004 8:106601291-106601313 CAGCCGGAACAGATAAAGACAGG - Intronic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047825439 8:128568938-128568960 GGGCAGCCACAAATGAAGAAAGG + Intergenic
1048630894 8:136241151-136241173 CAGCAGCAAGCGTTGAAGGATGG - Intergenic
1049014230 8:139908259-139908281 CAGCAGCACCAGTGGAGGAAGGG - Intronic
1049067557 8:140329372-140329394 CAGCAGCAACAAATTAAAAATGG + Intronic
1050206119 9:3198209-3198231 TACCAGCAAATGATGAAGAATGG - Intergenic
1051292138 9:15555326-15555348 TAGCAGTAATAGATAAAGAAAGG - Intronic
1051441088 9:17083967-17083989 CAGCAGCAAAACATGCAAAAGGG - Intergenic
1051602439 9:18888779-18888801 CGGCACAAAAAGATGAAGAAAGG + Intronic
1051742399 9:20264404-20264426 CAGCTGCAACACATGAAGCAGGG - Intergenic
1051938779 9:22478745-22478767 CAGCAGCAACACAGGAAAACTGG - Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1054821289 9:69522937-69522959 CACCTGCAAAACATGAAGAAGGG + Intronic
1055870696 9:80875896-80875918 CTAAAGCAATAGATGAAGAAAGG + Intergenic
1056817275 9:89811261-89811283 CAGCAGCAAAAGGTGAAGTTAGG + Intergenic
1057058686 9:91983798-91983820 CATCAGAAACAGATGCAGACAGG + Intergenic
1057581938 9:96294962-96294984 CATCAGCAGCAGATGAAGGACGG + Intronic
1057685743 9:97232836-97232858 CAGCAGGAAAACATGAACAAAGG - Intergenic
1057800298 9:98186944-98186966 CTGCAGCAACGGACGAAGACAGG - Intronic
1058354293 9:104064533-104064555 TAGCAACAACAGATCAAAAAAGG + Intergenic
1058508222 9:105688350-105688372 AAGGAGCAGAAGATGAAGAAAGG + Intergenic
1058561863 9:106238872-106238894 AAGGAGCAACAGAGGAAGTAAGG - Intergenic
1059295710 9:113268582-113268604 CAGCAGCAAGTGGTGAAGAATGG - Intronic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187580850 X:20605697-20605719 CAGCAGGAAGAGAGAAAGAAAGG + Intergenic
1187855416 X:23632210-23632232 CAGGAGCAAGAGAGAAAGAAGGG + Intergenic
1188969086 X:36591167-36591189 CAGAAGCAACAGCTGAAACAGGG + Intergenic
1190342142 X:49305429-49305451 AACCAGCAACACCTGAAGAAGGG + Exonic
1190344393 X:49323768-49323790 AACCAGCAACACCTGAAGAAGGG + Exonic
1190345483 X:49333312-49333334 AACCAGCAACACCTGAAGAAGGG + Exonic
1190346585 X:49342878-49342900 AACCAGCAACACCTGAAGAAGGG + Exonic
1190347833 X:49533906-49533928 AACCAGCAACACCTGAAGAAGGG + Exonic
1190348934 X:49543462-49543484 AACCAGCAACACCTGAAGAAGGG + Exonic
1190350036 X:49553018-49553040 AACCAGCAACACCTGAAGAAGGG + Exonic
1190351139 X:49562571-49562593 AACCAGCAACACCTGAAGAAGGG + Exonic
1190352240 X:49572129-49572151 AACCAGCAACACCTGAAGAAGGG + Exonic
1190353341 X:49581678-49581700 AACCAGCAACACCTGAAGAAGGG + Exonic
1190354445 X:49591222-49591244 AACCAGCAACACCTGAAGAAGGG + Exonic
1190355546 X:49600749-49600771 AACCAGCAACACCTGAAGAAGGG + Exonic
1190759593 X:53428384-53428406 CAGAAGCAGCAGCTCAAGAACGG + Exonic
1192135659 X:68597226-68597248 GTTCACCAACAGATGAAGAAAGG + Intergenic
1192548835 X:72037526-72037548 CAGCTGCACCAGATGTACAAAGG - Intergenic
1194192316 X:90852840-90852862 CAGGAGCAAGAGAGGAAGAGTGG - Intergenic
1194323465 X:92480932-92480954 CAGCAGCGACAGAGGCAGCATGG + Intronic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195963543 X:110409621-110409643 CAGCAGCAACAACAGAAAAATGG - Intronic
1196192132 X:112805854-112805876 CATCAGGATCAGAGGAAGAAAGG + Intronic
1197309925 X:124892193-124892215 CAGCATCAACAGATGATGAAGGG + Intronic
1197448573 X:126581441-126581463 CAGCAGCAATAAATGAAAGATGG + Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198590365 X:138173721-138173743 AACCAGCACCAGAAGAAGAATGG - Intergenic
1199140966 X:144311827-144311849 CTCCATCAACAGATGATGAATGG + Intergenic
1199732772 X:150652963-150652985 CATCTGCAAAAGATGAAGTATGG + Intronic
1199977919 X:152905223-152905245 CAGCAGAAACAGATGCTGAGAGG - Intergenic
1200109244 X:153731315-153731337 CAGCAGCTACAGAAGAAGCAGGG - Intronic
1200538951 Y:4435290-4435312 CAGGAGCAAGAGAGGAAGAGTGG - Intergenic
1200631566 Y:5594098-5594120 CAGCAGCGACAGAGGCAGCATGG + Intronic
1201244833 Y:11993474-11993496 CACCAGCAACAGAAGAAAACTGG - Intergenic
1201381121 Y:13380289-13380311 CAGCAGAAACAGGTAAAGACAGG + Intronic
1202106111 Y:21367858-21367880 CAGCAGAATCAGTTGAAGATGGG + Intergenic