ID: 1090678930

View in Genome Browser
Species Human (GRCh38)
Location 11:129032087-129032109
Sequence TCTGGGGTCCAGGAAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1173
Summary {0: 1, 1: 34, 2: 108, 3: 249, 4: 781}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090678930_1090678937 4 Left 1090678930 11:129032087-129032109 CCTGATTCTTCCTGGACCCCAGA 0: 1
1: 34
2: 108
3: 249
4: 781
Right 1090678937 11:129032114-129032136 GACTTGGATACAAGTGCAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090678930 Original CRISPR TCTGGGGTCCAGGAAGAATC AGG (reversed) Intronic
900234058 1:1578252-1578274 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
900907629 1:5571944-5571966 TCTGGCGTCCAGGAAGAATCAGG - Intergenic
900908969 1:5580602-5580624 TCTGGGGTCCTGGAAGGAAGAGG - Intergenic
901598407 1:10403153-10403175 TCTCGGAACCTGGAAGAATCTGG - Intronic
901691252 1:10974621-10974643 TCCTGTGTCCAGGAAGAATGAGG - Intronic
901872954 1:12148948-12148970 TCTGAGGTCCAGGGAGACTCGGG + Intergenic
901884880 1:12215847-12215869 TCTGGCATCCAGGAAGAATCAGG - Intergenic
901944549 1:12691199-12691221 CCTGGGGAACAGGAAGGATCTGG - Intergenic
902407270 1:16191631-16191653 TTTGGGGACCAGGAGGAATGAGG + Intergenic
902717120 1:18280566-18280588 TCTAGGGTGGAGGATGAATCGGG - Intronic
902747955 1:18485645-18485667 GCTGGGCTTCAGGAAGAATGTGG + Exonic
902749761 1:18499546-18499568 TCCAGCATCCAGGAAGAATCAGG - Intergenic
902828954 1:18997376-18997398 GCTAGGAACCAGGAAGAATCAGG + Intergenic
903019474 1:20383964-20383986 TCTGGGGCCCAGGAAGGATTTGG - Intergenic
903082424 1:20821029-20821051 TCCTGTGTCCAGGAAGAATGAGG - Intronic
904034284 1:27550737-27550759 ACTGGGGTCTGGGAAGATTCCGG + Exonic
904081829 1:27877072-27877094 TATGGGGGTCAGGATGAATCAGG + Intronic
904222487 1:28983918-28983940 TCCGGTGTCCAGGAAAAATGAGG + Intronic
904526325 1:31136488-31136510 TCCAGCATCCAGGAAGAATCAGG - Intergenic
904551835 1:31325296-31325318 TCTTGCATCCAGGAAGAATGAGG - Intronic
904577369 1:31513675-31513697 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
904598643 1:31662020-31662042 GCTGGGCTTCAGGAAGAATGAGG - Intronic
904619085 1:31764559-31764581 TCTGCGGTCCAAGAAGCAGCGGG - Intronic
905001383 1:34672401-34672423 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
905068625 1:35205917-35205939 TCTGGTGCCCAAGAAGAATCTGG + Intergenic
905522286 1:38609449-38609471 TCTGGCGTCCAGGAAGAATCAGG + Intergenic
905830213 1:41059596-41059618 TCTGGCATCCAGGAAGAATCAGG - Intronic
906132390 1:43468469-43468491 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
906854835 1:49292871-49292893 TCTTGTGTCCAGGAAAAATGAGG - Intronic
906860511 1:49353975-49353997 TTTTGTATCCAGGAAGAATCAGG - Intronic
907020319 1:51060403-51060425 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
907706773 1:56839317-56839339 TCTGACGTTCAGGAAGAATCAGG + Intergenic
908207924 1:61870126-61870148 TCTGGTATCCAGGAAAAATGAGG + Intronic
908730985 1:67226295-67226317 TCCAGTGTCCAGGAAGAATCAGG + Intronic
908896798 1:68910056-68910078 TCCAGTGTCCAAGAAGAATCAGG - Intergenic
909086423 1:71174186-71174208 TCTAGCATCCTGGAAGAATCAGG + Intergenic
909094491 1:71270741-71270763 TTCGGTGTCCAGGAAGTATCAGG + Intergenic
909185606 1:72481822-72481844 TCTGGTGTCTAGGAAGAATGAGG + Intergenic
909219027 1:72930600-72930622 TCTGGGGTGCAGTGAGAATGCGG - Intergenic
909570527 1:77105044-77105066 TCTGGTGTCCAAGAAGAATAAGG + Intronic
909802092 1:79822412-79822434 TCCGGCATCCAGAAAGAATCAGG + Intergenic
909837621 1:80276693-80276715 TCTGGTGCCCAGGAATAATCAGG - Intergenic
909930158 1:81488356-81488378 TCTGGGGAAAGGGAAGAATCTGG + Intronic
910149608 1:84126249-84126271 TCTGGCATCCAGGAAGAATAAGG + Intronic
910488916 1:87746440-87746462 TCTGGCATCCAGGAAGAATCAGG - Intergenic
910602081 1:89043124-89043146 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
911015010 1:93323042-93323064 TCTCGGATCCAAGCAGAATCTGG + Intergenic
911267001 1:95754213-95754235 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
911546609 1:99224978-99225000 TCCAGCGTCCAGGAAGAATTAGG + Intergenic
912008653 1:104933316-104933338 TCCGGAGTCCAGGAAAAATGAGG - Intergenic
912079258 1:105914321-105914343 TCCGGTGTCCAGGAAAAATGAGG - Intergenic
912612884 1:111066576-111066598 TCTGACATCCAGGAAGAATCAGG - Intergenic
912943007 1:114061440-114061462 TCTTGAGTCCAGGAAGAATGAGG - Intergenic
913097693 1:115534936-115534958 TCTGGTGTCCAGGAAAAACCAGG - Intergenic
913102984 1:115586777-115586799 TCTGGGGTTCAGGAATAATCAGG - Intergenic
914402455 1:147335677-147335699 TCTGGGGTAGAGGAGGAATGAGG + Intergenic
915258560 1:154656488-154656510 TTTGGAGTCCAGGAAGCAGCTGG - Intergenic
915637482 1:157196597-157196619 TCTTGCATCCAGGAAGAATGAGG - Intergenic
916337768 1:163692571-163692593 TCCAGCATCCAGGAAGAATCAGG + Intergenic
916384274 1:164249834-164249856 TCTGGCATCCAGGAAGAATCGGG - Intergenic
916648768 1:166816133-166816155 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
916705146 1:167341779-167341801 TGCGGCGTCCAGGAAGAATCAGG + Intronic
916951554 1:169785397-169785419 TCTGGCATCCAGGAAGAATCAGG + Intronic
917062589 1:171056558-171056580 TCTGGGCTCCTGGAACTATCAGG - Intronic
917087555 1:171319103-171319125 TCCAAAGTCCAGGAAGAATCAGG + Intronic
917211038 1:172632191-172632213 TCCGGAATCCAGGAGGAATCAGG - Intergenic
917539439 1:175898736-175898758 TCCAGCATCCAGGAAGAATCAGG - Intergenic
917539922 1:175902275-175902297 TCTGGCATCCAGGAAGAATCAGG - Intergenic
917588900 1:176457239-176457261 TCTGGCATCCAGAAAAAATCAGG + Intergenic
918171542 1:182002859-182002881 TCTGGCGCCCAGGAAGAATCAGG + Intergenic
918229148 1:182512687-182512709 TCTGGTGTCCAGCAAGAATCAGG + Intronic
918496743 1:185148212-185148234 TCTGGAGTTCAGGAAGAATGTGG - Intronic
918910564 1:190563055-190563077 TCTGGTGCCCAAGAAGAATGAGG - Intergenic
919083193 1:192891055-192891077 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
919656336 1:200200814-200200836 TCCAGCATCCAGGAAGAATCAGG - Intergenic
919833744 1:201559764-201559786 TCTGGGAAGGAGGAAGAATCTGG + Intergenic
920278316 1:204824953-204824975 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
920461123 1:206141232-206141254 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
920554788 1:206896828-206896850 TCTGGAAACCAGGAAGAATAAGG - Intergenic
920908105 1:210190085-210190107 GCTGTAGTCCAGGAATAATCAGG - Intergenic
920921181 1:210298528-210298550 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
921520950 1:216153170-216153192 TCCGGTGTCCAAGAAGAATCAGG - Intronic
922076892 1:222253901-222253923 ACTGGTGTCCAGGAGGAATGAGG - Intergenic
922334279 1:224606283-224606305 TCTGGCATCCAGGAAGAATCAGG + Intronic
922803246 1:228373516-228373538 TATGGGGTCAAGGAGGACTCAGG - Intronic
922876471 1:228943481-228943503 TCTGGCATTCAGGAAGAATGAGG - Intergenic
922906494 1:229177215-229177237 GCTGTAGTCCAGGAAGAGTCAGG - Intergenic
923291814 1:232553059-232553081 TCTGGAGTCCAGGAAGCATCAGG + Intronic
923911120 1:238445003-238445025 TTTGGCATCCAGGAAAAATCAGG - Intergenic
923944257 1:238864890-238864912 TCTGGCATCCAGGAAAAATGAGG + Intergenic
923957866 1:239042954-239042976 TCCGGCATGCAGGAAGAATCAGG - Intergenic
923975461 1:239257226-239257248 CCTAGCATCCAGGAAGAATCAGG + Intergenic
924467533 1:244312030-244312052 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
924673109 1:246148502-246148524 TCCTGTGTCCAGGAAGAATGAGG - Intronic
924804721 1:247353124-247353146 CCTGGTGTCCAGGAGGAATCAGG - Intergenic
1062769998 10:91854-91876 TCCTGTGTCCAGGAAGAATGTGG + Intergenic
1063131906 10:3185552-3185574 TGTGGGCTCCAGGAAGAAGTGGG - Intergenic
1063393946 10:5669208-5669230 TCTGGGCTCCAGGGAGAGACGGG + Intergenic
1063522958 10:6757670-6757692 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1063906413 10:10784402-10784424 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1064599370 10:16977609-16977631 TTTGGTGTCCAGGAAGAATCAGG - Intronic
1064599743 10:16981407-16981429 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1064600199 10:16985493-16985515 TCTGGCATCCAGGAAGAATCAGG - Intronic
1065009160 10:21406057-21406079 TCTGCTGTCCGGGAAAAATCAGG - Intergenic
1065009360 10:21407617-21407639 TTCAGTGTCCAGGAAGAATCAGG + Intergenic
1065304344 10:24354532-24354554 TCCTGCATCCAGGAAGAATCAGG + Intronic
1065454381 10:25891857-25891879 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1066108031 10:32172398-32172420 TCTGGGGTCCGGGACTAATAAGG + Intergenic
1066188924 10:33037516-33037538 TCTCAGGTCCAGGAAGAATGAGG - Intergenic
1066196662 10:33106786-33106808 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1066251491 10:33637380-33637402 TCCTGTGTCCAGGAAGAATCAGG - Intergenic
1066272548 10:33837633-33837655 TTTGGCATCCAGGAAAAATCAGG - Intergenic
1066281003 10:33918355-33918377 TTCGGTGTCCAGGAAGAATTGGG + Intergenic
1066305139 10:34133111-34133133 TCTGGCATCCAGGAAAAATCAGG - Intronic
1066564842 10:36710637-36710659 TCTGGAGTCCACAAAGAATCAGG - Intergenic
1067174496 10:43934034-43934056 CCTGGCATCCAGGAAGAATCAGG - Intergenic
1067258658 10:44666956-44666978 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1067319521 10:45205124-45205146 TCGCGGGTCCAGGAAGAGCCGGG - Intergenic
1067459717 10:46448827-46448849 TTTGGGGCCCAGGAAGGATACGG + Intergenic
1067627470 10:47935786-47935808 TTTGGGGCCCAGGAAGGATACGG - Intergenic
1067897644 10:50201252-50201274 TCCAGTGTCTAGGAAGAATCAGG - Intronic
1068178073 10:53487442-53487464 TCTGGCATCCAGGAAGAAGGAGG + Intergenic
1068497884 10:57808292-57808314 ACCGAGGTCCAGGAGGAATCAGG + Intergenic
1068681294 10:59823138-59823160 TCTGGCATCCAGGAAAAATGAGG - Intronic
1068907082 10:62338611-62338633 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1069038831 10:63673219-63673241 TCCGGAGTCCAGGAAGAATCCGG - Intergenic
1069125634 10:64629024-64629046 TCTGGCATCCAGGAGGAATGAGG - Intergenic
1069137808 10:64785810-64785832 TCTGGTGTCCAGGAGAAATGAGG - Intergenic
1069561727 10:69435520-69435542 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1069601080 10:69708542-69708564 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1069964726 10:72105095-72105117 TCTGGCATCCAAGAAGAATGAGG - Intronic
1070016921 10:72542794-72542816 TCTGGTGTCCAGGAAAATTGAGG + Intronic
1070679459 10:78438436-78438458 TCTGGAGTCCAGGCAGGATAAGG + Intergenic
1071124770 10:82321015-82321037 TCTGGCATCCAGAAAGAATCAGG - Intronic
1071388833 10:85149483-85149505 TTTGGTGTCCAGGAAGAATCAGG - Intergenic
1071490140 10:86130726-86130748 TCTGGCAACCAGGAAGAATCAGG - Intronic
1072154672 10:92714196-92714218 TCTTGTGTCCAGGAAGAATGAGG + Intergenic
1072208633 10:93226197-93226219 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1072335488 10:94394807-94394829 TCTTGTGTGCAGGAAGAATGAGG + Intergenic
1072470143 10:95706311-95706333 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1072486443 10:95860888-95860910 TCTTGTGTCCATGAAGAAACAGG - Intronic
1073394772 10:103208684-103208706 GCTGTAGTCCAGGAAGAGTCAGG - Intergenic
1073639958 10:105241578-105241600 TCTGGCATCCAAGAAGAATGAGG + Intronic
1073735094 10:106336366-106336388 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
1075013592 10:118894739-118894761 GCTGTAGTCCAGGAATAATCAGG - Intergenic
1075132032 10:119748471-119748493 TCCCGTGTCCAGGAAGAATGAGG + Intronic
1075439777 10:122470772-122470794 TCAGGAGTCCTGGAAGAGTCTGG - Intronic
1075653761 10:124147540-124147562 CCTGGGGTTCAGGCAGAAACAGG + Intergenic
1075786346 10:125052714-125052736 TGTGGGCTCCAGCAGGAATCTGG + Intronic
1076102534 10:127794491-127794513 TCCAGTGTCCAGAAAGAATCAGG - Intergenic
1076549085 10:131266536-131266558 TCTTGAGTCCAGAAAGAATGAGG + Intronic
1076655106 10:132018864-132018886 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1076851451 10:133095400-133095422 CCTGGTGTCCAGGAAGAAATGGG + Intronic
1077012876 11:386730-386752 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1077712998 11:4554455-4554477 TCTGGGGTCCAGGAAAAATCAGG - Intergenic
1077714762 11:4569650-4569672 TCTGGTATCCAGGAAAAATCGGG - Intergenic
1077818690 11:5714069-5714091 TCTGGGGTGCAGGAAGAGATTGG - Intronic
1078789090 11:14525251-14525273 GCTGTAGTCCAGGAATAATCAGG - Intronic
1080583910 11:33665174-33665196 TCCTGGGTCCAGGAAGAATAAGG + Intronic
1080723847 11:34875187-34875209 TCCAGCGTCCAGGAAGATTCAGG - Intronic
1080961662 11:37168061-37168083 TCCAACGTCCAGGAAGAATCAGG - Intergenic
1081001820 11:37682774-37682796 TCTAGAGTCCAGGAGGAATGAGG + Intergenic
1081010942 11:37811956-37811978 TATGGTGTCCAGGAAGAATGAGG + Intergenic
1081131136 11:39381614-39381636 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1081179156 11:39966143-39966165 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1081179485 11:39968560-39968582 TCCAGGTTCCAGGGAGAATCAGG - Intergenic
1081312795 11:41593900-41593922 TCTGACATCCAGGAAGAATTAGG + Intergenic
1081374226 11:42339947-42339969 TCCAGCATCCAGGAAGAATCGGG - Intergenic
1081693224 11:45092349-45092371 CCTGGGGTCCTGGAGGAGTCAGG - Intergenic
1082301574 11:50512314-50512336 TCTGGGCTACATGAAAAATCAGG + Intergenic
1082750049 11:57005619-57005641 TCCTGTGACCAGGAAGAATCTGG + Intergenic
1082896390 11:58195024-58195046 GCTTGGGGCCAGGAAGAATGAGG - Intergenic
1083140700 11:60718825-60718847 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1083263053 11:61533380-61533402 TCTGGGGAACAGGAAGAATGGGG - Intronic
1085061904 11:73454917-73454939 TCTGGCATCCAGGAAAAATGAGG - Intronic
1085513979 11:77101863-77101885 CCAGGGGCCGAGGAAGAATCTGG - Intronic
1085923077 11:80981993-80982015 TCCGGCAACCAGGAAGAATCAGG - Intergenic
1086493403 11:87377967-87377989 TCCGGTGTCCAAGAAGAATGAGG + Intergenic
1086508247 11:87528299-87528321 TCCTGTGTCCAGGAAGAATGTGG + Intergenic
1087602963 11:100339264-100339286 TCTGGTGTCCAAGAAGAATGAGG + Intronic
1087698798 11:101412492-101412514 TCTGGCATCCAGGAACAATCAGG - Intergenic
1087887244 11:103495123-103495145 TCTGGCGTCCAGGAAGAATTAGG - Intergenic
1087896278 11:103590070-103590092 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1087933729 11:104006887-104006909 TCTGGCATCCAGGAAGAATCAGG - Intronic
1087934208 11:104013282-104013304 TCTGGTATGCAGGAGGAATCAGG - Intronic
1088287911 11:108206758-108206780 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1088428357 11:109729785-109729807 TCTGGCACCCAGAAAGAATCAGG - Intergenic
1088448281 11:109955242-109955264 TCTGGTGTCCAGGAAGAATTGGG - Intergenic
1088450643 11:109977841-109977863 TCTGGCATCCAGGAAGAGTCAGG - Intergenic
1088777580 11:113100459-113100481 TCTGGCATCCAGGAAGAAGCAGG + Intronic
1089031028 11:115329710-115329732 TCCAGTGTCCAAGAAGAATCAGG + Intronic
1089043535 11:115477786-115477808 GCTGGGGTCCAGGCAGAGCCTGG + Intronic
1090116561 11:123979688-123979710 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1090135871 11:124198845-124198867 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1090554107 11:127855500-127855522 TCTGGCATCCAGGAGGAATCAGG + Intergenic
1090590409 11:128261281-128261303 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1090678930 11:129032087-129032109 TCTGGGGTCCAGGAAGAATCAGG - Intronic
1091239915 11:134045503-134045525 TCTAGGGACCAGGAAGAGGCAGG + Intergenic
1091663153 12:2399353-2399375 TCCGGGATCTAGGAAGAATCAGG + Intronic
1091812872 12:3414627-3414649 TCCGGCATCCAGAAAGAATCAGG + Intronic
1092237788 12:6820885-6820907 TCTGGGGACCAGGAATCTTCTGG + Intergenic
1092569067 12:9702146-9702168 TTTAGCGTCCAGGAAGAATCAGG + Intergenic
1092729073 12:11511339-11511361 TCTGAGGTCCAGGAGGCAGCTGG + Intergenic
1093183392 12:15992454-15992476 TCTGGAGGCAAGGAAGAACCAGG + Intronic
1093369684 12:18352630-18352652 TTCGGCATCCAGGAAGAATCAGG + Intronic
1093370298 12:18356577-18356599 TTTGATGTCCAGGAAGAATTAGG + Intronic
1093592318 12:20917574-20917596 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1093751773 12:22807997-22808019 TCTAATGCCCAGGAAGAATCAGG + Intergenic
1094412617 12:30183024-30183046 TCTGGCATCCAGGAGGAATGAGG - Intergenic
1094436432 12:30425299-30425321 TCCAGAGTCCTGGAAGAATCAGG - Intergenic
1094475001 12:30833975-30833997 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1094583091 12:31752328-31752350 TTCAGAGTCCAGGAAGAATCAGG + Intergenic
1094745586 12:33341130-33341152 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1095727556 12:45469887-45469909 TCTTGTGTCCAGGAAGAATGAGG - Intergenic
1095748121 12:45682254-45682276 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1096170220 12:49462590-49462612 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1096276377 12:50211730-50211752 TCTGAGGTACAGGAAGAAGGAGG + Intronic
1096777309 12:53972142-53972164 GTAGGGGTCCAGGAAGAATATGG - Intergenic
1097290847 12:57913745-57913767 TCCAGTGTCCCGGAAGAATCAGG - Intergenic
1097446441 12:59678292-59678314 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1097503695 12:60438285-60438307 TTTGGTGTCCAGGAAGAATCAGG + Intergenic
1097573189 12:61357332-61357354 CCTGTGATCCAGGAAGAATGAGG - Intergenic
1097746590 12:63310400-63310422 TCTAGTGCCCAGGAAGAATTAGG + Intergenic
1098173538 12:67769565-67769587 GCTGTGGTCCAGGAATAGTCAGG + Intergenic
1098314859 12:69182427-69182449 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1098545596 12:71707780-71707802 TCTGTCATCCAGGAAGAATCAGG + Intergenic
1098554648 12:71804529-71804551 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1098744070 12:74213487-74213509 TCCGGCATCCAGGAAGAATCAGG + Intergenic
1098757650 12:74386865-74386887 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1098951652 12:76645747-76645769 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1099425459 12:82518199-82518221 TCTGGTATCCAGGAAGAATCAGG + Intergenic
1099479030 12:83143076-83143098 TCTGGAGGCCAGGTAGAAGCAGG - Intergenic
1099601519 12:84745376-84745398 TCTGGTGTCCTGGAGGATTCTGG + Intergenic
1100293083 12:93235871-93235893 TTTGGTGTCCAGGAAAACTCAGG - Intergenic
1100531939 12:95469026-95469048 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1101148400 12:101863216-101863238 TTCGGCATCCAGGAAGAATCAGG + Intergenic
1101378019 12:104187760-104187782 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1101432843 12:104641218-104641240 TCTGGCATCCAGGAGGAATGAGG - Intronic
1101469589 12:104984159-104984181 TCTGCTGTCCAGAAAGAATCAGG + Intergenic
1101550242 12:105754704-105754726 TCCGGTGTCCAGGAAGAATCAGG + Intergenic
1101581917 12:106049377-106049399 TCTTGGGCCCAGGAAGCATAAGG - Intergenic
1102460325 12:113095890-113095912 TCTGGGGTGAAGAAAGCATCTGG - Intronic
1103859642 12:124002181-124002203 CCTGAGGACCAGGAAGAAACTGG + Intronic
1104096792 12:125565510-125565532 TCCAGTATCCAGGAAGAATCAGG + Intronic
1104143113 12:126007060-126007082 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1104145332 12:126028294-126028316 TCTTGGCTCCAAGCAGAATCGGG - Intergenic
1104833684 12:131772805-131772827 TCCGGCGTCCAGCAAGAATCAGG + Intronic
1105245997 13:18650786-18650808 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1105264956 13:18807833-18807855 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
1105972967 13:25447738-25447760 TCCAGTGTCCAGGAAGAATCAGG + Intronic
1106253460 13:28001534-28001556 TCCAGTGTCCAGGAAGAATGAGG + Intergenic
1106879417 13:34113017-34113039 TCTGGCAACCAGGAAGAATCAGG - Intergenic
1107147112 13:37070773-37070795 TCTTGTGACCAGGAAGAATGAGG - Intergenic
1107229102 13:38086674-38086696 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1107294404 13:38894412-38894434 TCTGGCGTCCAGGAAGAACCAGG - Intergenic
1107356345 13:39571582-39571604 TCCGGCATCCAGGAAGAATGAGG - Intronic
1107733785 13:43374743-43374765 TCTGTGGAGGAGGAAGAATCTGG - Intronic
1107841216 13:44459503-44459525 TCTCGTGTCCAGGAAGAATGAGG - Intronic
1107875056 13:44783045-44783067 TCTGGCATCCAGGAGGAATAAGG + Intergenic
1108104830 13:46997736-46997758 TCTGGTGTCCAGGAAGCATCAGG + Intergenic
1108159075 13:47618990-47619012 TCAGGTGTCCAGGAAGAATCAGG - Intergenic
1108849349 13:54708010-54708032 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1108967405 13:56326922-56326944 TTTGGAGTCCAGGAAAAATAGGG + Intergenic
1109006710 13:56886460-56886482 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1109029954 13:57179059-57179081 TCTTGTGTGCAGGAAGAATAAGG + Intergenic
1109182961 13:59235816-59235838 TCTGGGCTCAAGGAAGAGTTGGG - Intergenic
1109184422 13:59252060-59252082 CTTGGCATCCAGGAAGAATCAGG + Intergenic
1109204560 13:59467054-59467076 CCAGGTGTCCAGGAAGAATCAGG - Intergenic
1109458857 13:62627509-62627531 TCCGGCATCCAGGAAGAATCAGG + Intergenic
1109563387 13:64078791-64078813 CCTGGGGGCCAGGAACAGTCAGG - Intergenic
1109589774 13:64462988-64463010 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1109719741 13:66260453-66260475 TCCGGTGTCCGGGAAAAATCAGG + Intergenic
1109747723 13:66648102-66648124 TCTTGGCTCCAGGCAGATTCAGG - Intronic
1109780826 13:67107680-67107702 TCTCATGTCCAGGAAGAATGAGG - Intronic
1109915786 13:68983632-68983654 TCTTGTGTCCAGGAGGAATGAGG + Intergenic
1109944850 13:69420273-69420295 TCCAGTGTCCAGGAAGAATGAGG + Intergenic
1110003245 13:70232781-70232803 ACCGGCATCCAGGAAGAATCAGG + Intergenic
1110003723 13:70238704-70238726 TCTGGCATACAGGAAGAATCAGG - Intergenic
1110071312 13:71182496-71182518 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1110072237 13:71191641-71191663 TCTGGTGGCCAGGTAGAATCAGG + Intergenic
1110103840 13:71644864-71644886 TCTGGGGTCAAGGATGGAGCAGG + Intronic
1110158983 13:72352728-72352750 TCTGGCATCCAGGAAAAATGAGG + Intergenic
1110175769 13:72553856-72553878 TCTGGCATCCAGGAGGAATGAGG + Intergenic
1110433884 13:75458116-75458138 TCTGGCATCCAGGAGGAATCAGG + Intronic
1110582937 13:77153134-77153156 TCTGGCATTCAGGAAGAATCAGG - Intronic
1110939504 13:81331183-81331205 TCCTGTGTCCAGGAAGAATAAGG - Intergenic
1111251903 13:85612792-85612814 TCTGGCATCCAGGATGAATCAGG + Intergenic
1111451834 13:88428903-88428925 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1111487745 13:88926566-88926588 TCTTGTGTCCAGGAAGAACGAGG + Intergenic
1111607867 13:90564016-90564038 TCTGGTGTCCAGGAAGAATTAGG - Intergenic
1111800413 13:92974379-92974401 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1111878105 13:93921399-93921421 TCTGACATACAGGAAGAATCAGG + Intronic
1112019153 13:95356722-95356744 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1112171471 13:96977088-96977110 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1112259786 13:97867759-97867781 TCTGGTGTCCAGGTAGAATCAGG - Intergenic
1112261491 13:97881946-97881968 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1112547154 13:100382127-100382149 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1113055087 13:106259382-106259404 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1113456218 13:110450622-110450644 TCTGGGGTCCACGCAGGAGCTGG + Intronic
1113564833 13:111313514-111313536 TGTGAGGTCCAGGCAGGATCAGG - Intergenic
1113883886 13:113647261-113647283 TCTGGTGTCCATGGAGAGTCTGG + Intergenic
1114345464 14:21789908-21789930 TCCGGCGTCGAGGAAGAATCAGG - Intergenic
1114980465 14:28157879-28157901 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1115310531 14:31974350-31974372 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
1115904906 14:38193587-38193609 GCTGTAGTCCAGGAATAATCAGG - Intergenic
1116035944 14:39627184-39627206 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1116159707 14:41253289-41253311 TCTCATGTCCAGGAAGAATAAGG + Intergenic
1116257283 14:42571852-42571874 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1116479741 14:45383702-45383724 TCTGGCATCCAGAAAGAATCGGG - Intergenic
1116523817 14:45880539-45880561 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
1116526367 14:45910676-45910698 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1116789942 14:49329588-49329610 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1117084758 14:52188084-52188106 TCTAGTGTCCAAGAAGAATGAGG - Intergenic
1117285435 14:54282253-54282275 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1117390371 14:55256641-55256663 TCTGGCATCCAGGAATAATCAGG - Intergenic
1117450546 14:55845613-55845635 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1117823602 14:59677144-59677166 GCTGGGGTCCTGGAAGAAGAGGG - Intronic
1117928585 14:60812898-60812920 TCTGGCATCCAAGAAGAATGAGG - Intronic
1117944017 14:60998578-60998600 TCCTGTGTCCAGGAAGAATCAGG - Intronic
1118408506 14:65451601-65451623 TCTGGCGCCCAGGAAAAATGAGG + Intronic
1118647959 14:67858251-67858273 TCTGGCATCCAAGAAGAATGAGG + Intronic
1119137938 14:72237976-72237998 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1119282001 14:73417200-73417222 TCTGGCATCCAGGAAGGATAAGG - Intronic
1119473296 14:74912353-74912375 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119473304 14:74912390-74912412 TCTGGGGTCCAGGTGGAACAGGG - Intronic
1119555675 14:75550662-75550684 GCTGTGGTACAGGAAGAACCAGG - Intergenic
1119913331 14:78371464-78371486 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1120218357 14:81704900-81704922 TCTGGTGTCCAGGGAGAATCAGG + Intergenic
1120474465 14:84969800-84969822 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1120523290 14:85549154-85549176 TCTGGCATCCAGGGGGAATCAGG - Intronic
1120614704 14:86688901-86688923 TCCGGCGTCCGGAAAGAATCAGG - Intergenic
1120685380 14:87531203-87531225 TCCAGCGTCCAGGAAAAATCAGG - Intergenic
1120806146 14:88752990-88753012 TCCAGCGTCCAGGAAGAACCAGG - Intronic
1121193192 14:92047629-92047651 GCTGTAGTCCAGGAATAATCAGG + Exonic
1121215242 14:92242576-92242598 TCTGGGGACCAGGCTCAATCAGG + Intergenic
1121553300 14:94818705-94818727 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1121666538 14:95676718-95676740 TCCAATGTCCAGGAAGAATCAGG - Intergenic
1121695286 14:95907551-95907573 TCCGGCATCCAGGAAGAATGAGG + Intergenic
1121737450 14:96228374-96228396 TCTGGCATCCAGGAAGAATCAGG + Intronic
1122452713 14:101823677-101823699 TCTGAGGTCCAAGAAGGAGCTGG + Intronic
1122935539 14:104954372-104954394 GCTGGGGTCCTGGAAGAGTTGGG - Exonic
1123174535 14:106403862-106403884 ACTGGGGTACAGGAAGTAACTGG + Intergenic
1123182756 14:106484807-106484829 ACTGGGGTACAGGAAGTAACTGG + Intergenic
1202833508 14_GL000009v2_random:60281-60303 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
1202883657 14_KI270722v1_random:84429-84451 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1202944151 14_KI270726v1_random:11922-11944 ACTGGGGTACAGGAAGTAACTGG - Intergenic
1124035291 15:26048851-26048873 CCTGGGGCCCAGGGAGAAGCGGG - Intergenic
1124096220 15:26651003-26651025 TCTGGCATCCAAGAAGAATGAGG - Intronic
1124530072 15:30498110-30498132 CCTGGCATCCAGGAAGAATCAGG - Intergenic
1124768587 15:32509578-32509600 CCTGGCATCCAGGAAGAATCAGG + Intergenic
1124937644 15:34187398-34187420 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1125238824 15:37549914-37549936 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1125433741 15:39624752-39624774 CCTGGGGGCCAGGGACAATCTGG + Intronic
1126322907 15:47444894-47444916 TCCAGCGTCCAGGAAAAATCAGG + Intronic
1126405099 15:48315346-48315368 CCGGGCATCCAGGAAGAATCAGG + Intergenic
1126654103 15:50957153-50957175 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1126840352 15:52711571-52711593 TTTGGGGTCCTGGAGGAAACTGG - Intergenic
1126984096 15:54282724-54282746 TCTGGTGTCCAAGAAGAATGAGG + Intronic
1127253297 15:57265312-57265334 TTTGGGGTGAAGGAAGAAACCGG - Intronic
1127768307 15:62209393-62209415 TCTGGGTTCCAAGAAGAATAAGG - Intergenic
1127979461 15:64024059-64024081 GCTGGGGTCCTGGAAGACCCTGG + Intronic
1128284644 15:66426558-66426580 TCTGGGGTTCAGGAAGAGGAAGG + Intronic
1128479837 15:68027746-68027768 TCTGGAGTCCAGGAGGAATAAGG + Intergenic
1128790647 15:70431395-70431417 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1128995276 15:72290287-72290309 TCGGGGGTCTAGGAAGACTTGGG - Intronic
1129019609 15:72504401-72504423 TCTGGTGTCCAAGAAAAATGAGG + Intronic
1129170029 15:73801912-73801934 TCTGGACTCCAGGAAGAAAGTGG + Intergenic
1129368982 15:75076187-75076209 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1130420816 15:83745283-83745305 TCCAGCGTCCAGGAAAAATCAGG - Intronic
1131365673 15:91837302-91837324 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1131574975 15:93579598-93579620 CTTGGGGTCCAGGAGGAATAGGG + Intergenic
1131709534 15:95037912-95037934 TCTGGCATCCAGGCAGAATCAGG - Intergenic
1131881554 15:96867817-96867839 TCTGGCATCCAGGAAAAATGAGG - Intergenic
1131885494 15:96907705-96907727 TCCGGCGTCCAAGAAGAATTAGG + Intergenic
1131999185 15:98162601-98162623 TCTAGAGTCCAGGAAGAATGAGG + Intergenic
1132541961 16:514321-514343 TCTGGTGTACAGGAAGACCCTGG + Intronic
1132645444 16:997357-997379 TCGGGGGCCCAGGGAGAAGCAGG - Intergenic
1133060985 16:3174490-3174512 TCTGGGGTCCTGGAAGAAATAGG + Intergenic
1133064434 16:3195958-3195980 TCTGGGGTCCTGGAAGCCCCAGG - Intergenic
1133695659 16:8260154-8260176 TTTGGCATCCAGGAAGAATCAGG - Intergenic
1133808788 16:9145360-9145382 TTCGGCATCCAGGAAGAATCAGG - Intergenic
1133816803 16:9203794-9203816 TCTGGCATCCAGGAAAAATGAGG - Intergenic
1133843922 16:9436791-9436813 TCTCATGACCAGGAAGAATCAGG - Intergenic
1134602315 16:15543030-15543052 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1135081561 16:19440581-19440603 TCCAGGATCCAGAAAGAATCTGG + Exonic
1135672491 16:24387202-24387224 TCGAGAGTCCAGGAACAATCAGG + Intergenic
1135674863 16:24406728-24406750 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
1135675566 16:24412140-24412162 TCCTGGGTCCAGGAAGACTGTGG + Intergenic
1135678407 16:24436788-24436810 TTTGGTGTCCAGGAAGAATCAGG - Intergenic
1135986847 16:27190196-27190218 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1136071884 16:27792252-27792274 TCTGGGGTCCAGCAAGGACTTGG - Intronic
1136636956 16:31530000-31530022 TCGGTGGTCCAGGCAGAGTCTGG + Intergenic
1137720231 16:50623389-50623411 GCTGGGCTCCAGGAAGAAGCTGG - Intronic
1137825218 16:51489139-51489161 TCTGGCATCCAGGAAGAATGAGG + Intergenic
1138534210 16:57651368-57651390 CCTGGGGTCAGGGAAGGATCGGG - Exonic
1138902962 16:61296681-61296703 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1139328031 16:66167012-66167034 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1139389959 16:66601237-66601259 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1140564618 16:76027090-76027112 TCAGGCGTCCAGGAGGAATGCGG - Intergenic
1140688941 16:77462848-77462870 TCTGGGGTCCAGAAAATCTCTGG + Intergenic
1141182588 16:81764420-81764442 TGTGGGATGGAGGAAGAATCAGG + Intronic
1141404052 16:83775913-83775935 TCTGGGGCCCAGGAAATATAGGG - Intronic
1142301739 16:89262626-89262648 TCTGGCATCCAGGAAAAATGAGG + Intergenic
1142864962 17:2785141-2785163 CAGGGGGCCCAGGAAGAATCTGG + Intronic
1143130179 17:4672806-4672828 TCTCAGGGCCAGGAAGAAGCCGG + Exonic
1143535815 17:7538739-7538761 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1143736335 17:8914250-8914272 GCTGAGGTCCAGGAAGGATAAGG + Intronic
1144305398 17:13965550-13965572 TCCGGTGTCCAGAAAAAATCAGG + Intergenic
1146379106 17:32315283-32315305 TATGTGTTCCAGGAAGATTCCGG + Intronic
1146425362 17:32732680-32732702 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1146761582 17:35483333-35483355 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1146824064 17:36008386-36008408 TCTGACATCCTGGAAGAATCAGG - Intergenic
1146824683 17:36012292-36012314 TCTGGCATCTAGGAAGAATCAGG - Intergenic
1147230195 17:39012087-39012109 TCTGGCATCCAGGAGGAATGAGG - Intergenic
1147569518 17:41560051-41560073 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1147994323 17:44352883-44352905 AATGGGGTCCAGGGAGAATTTGG - Exonic
1148795570 17:50195151-50195173 TCTGGGGAGCAGGAAGACGCAGG - Intronic
1148957598 17:51366433-51366455 TCCAGCGTCCAAGAAGAATCAGG - Intergenic
1149057152 17:52379957-52379979 TCTGGTGCTCAGGAAGAATGAGG - Intergenic
1149088737 17:52751811-52751833 TCTTGTGTCCAGAAAGAATGAGG - Intergenic
1149237289 17:54607291-54607313 TCTGGCATCCAGGAAAAATGAGG - Intergenic
1149482863 17:57017662-57017684 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1150469045 17:65420450-65420472 TCTATGCTACAGGAAGAATCAGG + Intergenic
1150521105 17:65866900-65866922 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1150932095 17:69596093-69596115 TCTGGCATCCAAGAAGAATTAGG - Intergenic
1151018480 17:70584715-70584737 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1151276873 17:73041478-73041500 CCTGGGGTACAGGAGGAATCTGG - Intronic
1151533186 17:74720800-74720822 TCAGGTGTCCAGGAAGAATCAGG + Intronic
1151823290 17:76508914-76508936 TGAGGGGTCCAGGAAGCAGCTGG + Intergenic
1151839652 17:76608877-76608899 GCTGTGGTCCAGGAATAGTCAGG + Intergenic
1151895208 17:76975413-76975435 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1152864151 17:82712293-82712315 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1153131073 18:1856278-1856300 TCAGGGGTCCAGGAACAAAGGGG - Intergenic
1153369171 18:4294740-4294762 TCCAGCATCCAGGAAGAATCAGG + Intronic
1153411898 18:4802886-4802908 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1153632609 18:7086473-7086495 CCTGGGGTTCAGGAAAGATCTGG - Intronic
1153681435 18:7504726-7504748 TCTGGCATCCAAGAAGAATTGGG + Intergenic
1153703965 18:7725830-7725852 TCTGGCGTCCAGAAGGAATGAGG - Intronic
1154155908 18:11943981-11944003 TCTGGTGTCCAGAAAGAATTAGG + Intergenic
1154423437 18:14253710-14253732 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
1154442920 18:14408878-14408900 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1155683719 18:28521007-28521029 TCCAGCGTCTAGGAAGAATCAGG - Intergenic
1155859388 18:30877993-30878015 TTTGGGGTCCAGGAAACATTTGG + Intergenic
1156311543 18:35926924-35926946 TCTGGAGTCCAGGAAGAATCAGG - Intergenic
1156470068 18:37371829-37371851 TCAGGGGCCCAGGAAGAACAAGG + Intronic
1156684375 18:39627134-39627156 TCCAGTGTCCGGGAAGAATCAGG + Intergenic
1156905626 18:42348817-42348839 TCTGGCATCCAAGAAGAATTAGG - Intergenic
1157014779 18:43698915-43698937 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1157119783 18:44898139-44898161 TGTGGGATCCAGAAAGAATGTGG - Intronic
1157395784 18:47339772-47339794 TCAGGGGTTCAGGAAGGGTCAGG + Intergenic
1157719660 18:49914062-49914084 TACAGGGTCCTGGAAGAATCAGG - Intronic
1157792570 18:50545866-50545888 TCTGGCGTCCAGGAAAAATGAGG - Intergenic
1157922112 18:51723858-51723880 TCTGGGGTACAGGGAGTGTCTGG + Intergenic
1157958602 18:52126758-52126780 TTTGGAGTCCAGGAAGAATCAGG - Intergenic
1158057881 18:53303840-53303862 TCCAGCATCCAGGAAGAATCAGG + Intronic
1158184833 18:54759966-54759988 TTTGGTGTCCAGGAAGAATCAGG - Intronic
1158198005 18:54910006-54910028 TCTGGCAACCAGGAAGAATGAGG + Intronic
1158633054 18:59132742-59132764 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1158829145 18:61258835-61258857 TCTGGGATCAAGTAAGAAACAGG + Intergenic
1158968558 18:62644763-62644785 TCTGGTGTCCAGGAAAAATCAGG - Intergenic
1159186738 18:64984427-64984449 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1159447372 18:68557431-68557453 TCTGGCCTCCAGGAAGAATCAGG + Intergenic
1159623906 18:70669922-70669944 TCCTGTGTCCAGGAAGAATTAGG - Intergenic
1159726595 18:71967951-71967973 TTTGGCATCCAGGAAGAATCGGG - Intergenic
1160149474 18:76388207-76388229 TCTGGTGTCCAGGAAGAATCGGG - Intronic
1160292897 18:77609983-77610005 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1160963399 19:1734782-1734804 TCTGGGGTACAGAAAGAGACTGG + Intergenic
1161062712 19:2223110-2223132 TGTGAGGACCAGGAAGAACCAGG + Intronic
1162178159 19:8847157-8847179 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1162231667 19:9271445-9271467 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1162531291 19:11237771-11237793 TCGGGGGACCTGGCAGAATCGGG + Exonic
1164147088 19:22518748-22518770 TCTGGGCTCGCGGAAGAAGCTGG + Intronic
1164159546 19:22617580-22617602 TCTGGGCTCACGGAAGAAGCTGG - Intergenic
1164672517 19:30080796-30080818 TCTGGGGTCCTGGGGGAAGCTGG + Intergenic
1164706016 19:30320788-30320810 TCTTGGCTCCCGGGAGAATCAGG + Intronic
1164966287 19:32487551-32487573 TCTGGCATCCAGGAACAATCAGG - Intergenic
1165022709 19:32937012-32937034 TCCTGCGTCCAGGAAGAATGAGG - Intronic
1165202150 19:34153849-34153871 TCCGGCATCCAGGAAGGATCAGG + Intergenic
1165300868 19:34967939-34967961 TCTGGCATCCAGGAGGAATGAGG - Intergenic
1167013231 19:46822481-46822503 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1167303005 19:48690251-48690273 TCTGAGGTTAAAGAAGAATCAGG + Intergenic
1167346301 19:48947530-48947552 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1167480457 19:49727506-49727528 ACTGGTGTCCAGGAAGAATTAGG - Intergenic
1168303491 19:55420254-55420276 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1202632810 1_KI270706v1_random:15881-15903 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1202639162 1_KI270706v1_random:67414-67436 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
1202653068 1_KI270707v1_random:24168-24190 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1202659084 1_KI270708v1_random:51577-51599 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
925219482 2:2126452-2126474 TCTGGGGCCCAGAAAGAAGAGGG + Intronic
925544651 2:5003775-5003797 GCTGTGGTCCAGGAATAGTCAGG - Intergenic
925785774 2:7430611-7430633 TCAGGGCTCCACGTAGAATCAGG - Intergenic
925973761 2:9126389-9126411 GCTGGGGTCCAGGAAGCTTCTGG - Intergenic
926464833 2:13175459-13175481 TCTGGCATCCAAGAAGAATCAGG + Intergenic
926468886 2:13227930-13227952 TCTGGGATCCACTAACAATCAGG + Intergenic
926506471 2:13721968-13721990 TCCGGCATCCAGGAAGAATCAGG - Intergenic
926859202 2:17291277-17291299 TCTTGCATCCAGGAAGAATGAGG + Intergenic
927072976 2:19548994-19549016 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
927262194 2:21102729-21102751 TCTGGTGTCCAAGAAGTATCAGG + Intergenic
927322381 2:21762485-21762507 TCCGGCATCCAGGAAGAATTAGG + Intergenic
927338382 2:21951918-21951940 TTTGGGGTCACGGAAAAATCAGG - Intergenic
928130474 2:28645435-28645457 TATGGGGACCAGGAAAAATGAGG + Intergenic
928494014 2:31813363-31813385 TCTGGCATCCAGGAAGAATCAGG + Intergenic
928664476 2:33537030-33537052 TCTGGCATCTAAGAAGAATCAGG + Intronic
928869647 2:35961413-35961435 TCTGGCAGCCAGGAAGAATCGGG + Intergenic
929014629 2:37482052-37482074 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
929563242 2:42968785-42968807 TGAGGAGTCCAGGAACAATCTGG + Intergenic
929832241 2:45356443-45356465 TCTGGAGCTCAGGAAGAGTCTGG - Intergenic
929901607 2:46008526-46008548 TCTGGGGACCAGGAAGCTCCTGG + Intronic
929993787 2:46812257-46812279 TGTGGGGTCCAGGAAGAGTGGGG - Intergenic
930074004 2:47391905-47391927 TCTGGCATCCAGGAAGAATCAGG + Intergenic
930144727 2:47990288-47990310 TCTGGACTCAGGGAAGAATCTGG - Intergenic
930800615 2:55438891-55438913 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
930946589 2:57083904-57083926 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
931300576 2:60974421-60974443 TCTTGCGTCCAGGAAGAATGAGG - Intronic
931401183 2:61932971-61932993 TCTGGCATCTGGGAAGAATCAGG + Intronic
931414987 2:62072528-62072550 TCCCGTGTCCAAGAAGAATCAGG - Intronic
931458682 2:62432279-62432301 TCTGAGGTCTAGGAGGAATGAGG - Intergenic
931567268 2:63627809-63627831 TTCGGCGTCCAGGAAAAATCAGG - Intronic
932594027 2:73083222-73083244 CCTGGGTTCCTGGGAGAATCCGG - Intronic
933026887 2:77271171-77271193 TCTGGCGTCCAAGAAGAATGAGG - Intronic
933250616 2:80024871-80024893 TCTGGTGTCCAGGAAGAATTAGG + Intronic
933298210 2:80514514-80514536 TCTGGTGTCCAAGAAGAATGAGG + Intronic
933425969 2:82112633-82112655 TCTGGTGTCCAGGAAGAACTGGG - Intergenic
933427029 2:82126475-82126497 TGTGGCATCCAGGACGAATCAGG + Intergenic
933544693 2:83695355-83695377 TCCAGCATCCAGGAAGAATCAGG + Intergenic
933846185 2:86328974-86328996 CCCGGGTTCCAGGAAGAACCCGG + Intronic
934040463 2:88124029-88124051 TCTGGGGGCAAAGAAGAGTCAGG + Intronic
934491033 2:94762173-94762195 TCTGGGGTGCAGGGAGAGGCAGG + Intergenic
934791742 2:97067992-97068014 TCTGGCATCTAGGAAGAATTAGG + Intergenic
934969380 2:98750682-98750704 TCCGGCATCCAGGAAGAATCAGG - Intergenic
935261010 2:101355971-101355993 TCTGGCATCCAGGAAGAATCAGG + Intronic
935331741 2:101982412-101982434 TCTGGGGTCCACGTTGACTCAGG - Intergenic
935958186 2:108399333-108399355 TCTAGTGACCAGGAGGAATCAGG - Intergenic
936478950 2:112867637-112867659 TCTGGGGACCAACAAGAAGCAGG - Intergenic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
936657639 2:114506428-114506450 TCTGGCATCCAGGAGGAATAAGG - Intronic
937163974 2:119794812-119794834 TCCTGTGTCCAGGAAGAATGAGG + Intronic
937672311 2:124551129-124551151 GCTGGGGTTCAAGAAGAAGCCGG - Intronic
937840416 2:126519159-126519181 TTTGGCATCCAGGAAGAATCAGG - Intergenic
938509558 2:131926204-131926226 TCTGACATCCAGGAAGAATCAGG - Intergenic
938549944 2:132370722-132370744 TCCAGAATCCAGGAAGAATCAGG + Intergenic
938722045 2:134075894-134075916 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
938755058 2:134371867-134371889 TCTGTGTTCCAGGGAGATTCAGG + Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
939340962 2:140895643-140895665 ACTGGGTGTCAGGAAGAATCAGG + Intronic
939356898 2:141114346-141114368 TCTGGTGGCCAGGAAGAATCAGG + Intronic
939384289 2:141475923-141475945 TCTGGTGTCCAGGAAGAATCAGG - Intronic
939460123 2:142488388-142488410 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
939500282 2:142975411-142975433 TCTGGCATACAGGAAGAATGAGG - Intronic
939583992 2:143984920-143984942 TCCAGCGTCCAGGAAGAATCAGG - Intronic
939590860 2:144062043-144062065 TCTGGCATCCAGGAAGAATCAGG - Intronic
939776130 2:146390609-146390631 TCTAGCATCTAGGAAGAATCAGG + Intergenic
939837729 2:147150720-147150742 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
940183788 2:150961100-150961122 GCTGTAGTCCAGGAATAATCAGG - Intergenic
940508688 2:154586151-154586173 GCTGTAGTCCAGGAATAATCAGG + Intergenic
940629379 2:156218332-156218354 TCTGTGAACCAGGAAGAAGCTGG + Intergenic
940659995 2:156534024-156534046 TCTGGTATCCAGGAAGTATCAGG + Intronic
941717548 2:168779808-168779830 TCCGGCATCCAGGCAGAATCAGG - Intergenic
941852240 2:170195554-170195576 TCCAGTGTCCAGGAAGAATCAGG - Intronic
941996395 2:171605603-171605625 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
942105523 2:172629619-172629641 TTTGGCGTCCAGGAAGAATCAGG - Intergenic
942173358 2:173308472-173308494 TCCAGTGTCCAGGAAAAATCAGG - Intergenic
943064157 2:183069546-183069568 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
943746025 2:191463542-191463564 TCCAGCATCCAGGAAGAATCAGG + Intergenic
943749172 2:191493984-191494006 TCCGGCGTACAGGATGAATCAGG + Intergenic
944251127 2:197580906-197580928 GCTGTGGTCCAGGAATAGTCAGG - Intronic
944891053 2:204117743-204117765 TTTGGTGTCCAAGAAGAATCAGG + Intergenic
944945423 2:204678419-204678441 TCTGGCATCCAGGAAGAATCAGG + Intronic
945180577 2:207087234-207087256 TCTGGGCTCCAGGACGCATGGGG + Intronic
946100451 2:217315906-217315928 TCCTGTGCCCAGGAAGAATCAGG - Intronic
946609417 2:221441529-221441551 TCTGGTGTCCAGGAAGAATCAGG - Intronic
946712176 2:222517552-222517574 TCCAGTGTCCAGGAAGGATCAGG - Intronic
947401145 2:229732651-229732673 TTTGGTGTCCAGGAAGAATCAGG - Intergenic
948432783 2:237930666-237930688 TCTCATGTCCAGGAAGAATGAGG - Intergenic
948559163 2:238839262-238839284 TCTGGGGAGCAGGAAGTTTCAGG + Intergenic
948575340 2:238946288-238946310 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1168983360 20:2026551-2026573 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1169235022 20:3924037-3924059 TCAGGGGATCAGGGAGAATCTGG + Intronic
1169324524 20:4664535-4664557 TTTGGTGTCCAGGAAGAATCAGG + Intergenic
1170105477 20:12750636-12750658 TCCGACATCCAGGAAGAATCAGG - Intergenic
1170314874 20:15031410-15031432 TCTGGCATCCAGGAAGAATGAGG + Intronic
1171211545 20:23320918-23320940 TCCGGCATCCAGGAAGAATCAGG + Intergenic
1171308441 20:24125963-24125985 TCTTGGAGCCAGGAAGACTCTGG - Intergenic
1171885754 20:30651529-30651551 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
1172347080 20:34210122-34210144 TCCTGCGTCCAGGAAGAATGAGG - Intronic
1172408044 20:34704013-34704035 GCTGCGATCCGGGAAGAATCAGG + Intronic
1173389976 20:42623155-42623177 TTTGGAGTCTAGGAAGAATGAGG - Intronic
1173893885 20:46534873-46534895 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1175843015 20:62042396-62042418 TGCGGTGTCCAGGAAGAATCAGG - Intronic
1176453163 21:6882326-6882348 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1176599085 21:8775483-8775505 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1176645024 21:9341761-9341783 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1176647485 21:9365023-9365045 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
1176783922 21:13232354-13232376 TCTGACATCCAGGAAGAATCAGG + Intergenic
1176831336 21:13747374-13747396 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1176973211 21:15289766-15289788 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1176981029 21:15381138-15381160 TCTGATGTTCAGTAAGAATCAGG - Intergenic
1177357769 21:20031304-20031326 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1177363664 21:20105169-20105191 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
1177801596 21:25833785-25833807 TCTGGCTTCCAGGAAAAATGAGG - Intergenic
1177967341 21:27744446-27744468 TCTGGCATCCAAGAAGAATGAGG + Intergenic
1177981970 21:27926187-27926209 TCTGACATCCAGGAAGAATCAGG + Intergenic
1178041194 21:28642587-28642609 TCTGGTGTCCAAGAAGAATCAGG + Intergenic
1178087035 21:29122423-29122445 TTCAGTGTCCAGGAAGAATCAGG + Intronic
1178164859 21:29962027-29962049 TCCGGCATCCAGGAACAATCAGG + Intergenic
1178222426 21:30675235-30675257 TATGGCATCCAGGAAGAATCAGG - Intergenic
1178223694 21:30689813-30689835 TCTGGTGTTCAGGAGGAATGAGG - Intergenic
1178447377 21:32658493-32658515 TCTGGTGTCCAGGAGGAATGAGG - Intronic
1180178856 21:46108876-46108898 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1180326545 22:11435093-11435115 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1180362788 22:11914450-11914472 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
1180367927 22:11957473-11957495 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1180378161 22:12113863-12113885 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1180419345 22:12799418-12799440 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1181174482 22:21027934-21027956 TCTGGGCCCCAAGGAGAATCAGG - Exonic
1181450086 22:23014012-23014034 TCCAATGTCCAGGAAGAATCAGG + Intergenic
1182867749 22:33619130-33619152 TCTCGTGACCAGGAAGAATTAGG - Intronic
1184173933 22:42775383-42775405 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1184205364 22:42999040-42999062 TCTGGCGTCCAGGAAGAATCAGG - Intronic
1184335369 22:43849712-43849734 TCTGGCATCCAGGAGGAATGAGG - Intronic
1184747876 22:46466402-46466424 TCTGGGCACCAGGAAGAAAGAGG - Intronic
1185367490 22:50443572-50443594 TCTGGGGTCCTTGAAGAATGAGG + Intronic
949463885 3:4323810-4323832 TTTGGGGTGCAGGGAGAATGTGG + Intronic
949464780 3:4333120-4333142 TCCAGTGTCCTGGAAGAATCAGG - Intronic
949767287 3:7541074-7541096 TATGGGGGCCAGGAAAAGTCAGG + Intronic
949956641 3:9274641-9274663 TCTGGCATCCAGGAGGAATGAGG + Intronic
950204454 3:11068011-11068033 TCCAGCGTCCAGGAGGAATCAGG - Intergenic
950207663 3:11092998-11093020 TCTTGTGTCCAAGAAGAATGAGG - Intergenic
950332713 3:12169238-12169260 CTTGAGGTACAGGAAGAATCAGG + Intronic
951319352 3:21226108-21226130 TCTGCTGTCCAGGAAAAATGAGG - Intergenic
951515776 3:23557548-23557570 TTTGGGGTGTAGGAAGAAACTGG + Intronic
951991222 3:28677921-28677943 TTTGGCGTCCAGGAAGAATCAGG + Intergenic
952181466 3:30920816-30920838 TCTGGTGTCCAGGAAAAATGAGG - Intergenic
952296974 3:32070395-32070417 ACTGTAGTCCAGGAATAATCAGG - Intronic
952561785 3:34603723-34603745 TCTGGTGTCCAGAAGGAATGAGG - Intergenic
952785787 3:37153617-37153639 TCTGTGGTCCAGGAATACTCTGG - Intronic
952853594 3:37749467-37749489 GCTGGGGAGCAGGAAGAATAGGG - Intronic
953656465 3:44858596-44858618 GCTGTAGTCCAGGAATAATCAGG + Intronic
954122006 3:48504872-48504894 GCAGGGGTCCAGGCAGAATCAGG + Intergenic
954574905 3:51670713-51670735 TCTGGGCTCGCGGAAGAAACTGG - Intronic
954879185 3:53822454-53822476 GCTGGGGTCCTGGAAGAAGGGGG - Intronic
955090881 3:55749384-55749406 GCAGGGGTCAAGGAAGAATGGGG + Intronic
955119777 3:56046327-56046349 ACATGGGTCCAGGAAGAAGCTGG + Intronic
955588987 3:60514138-60514160 TCTGGCATCCAGGAAGAATCAGG - Intronic
955749004 3:62168826-62168848 TCTGGCGTCCAGGAACAATCAGG + Intronic
955950332 3:64237286-64237308 TCTGGCATCCAGCAGGAATCAGG + Intronic
956541458 3:70344512-70344534 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
956689304 3:71861197-71861219 TCCCACGTCCAGGAAGAATCAGG - Intergenic
957244723 3:77702470-77702492 TTAGGCATCCAGGAAGAATCAGG - Intergenic
957287767 3:78239131-78239153 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
957292485 3:78295199-78295221 TTCGGCATCCAGGAAGAATCAGG - Intergenic
957347820 3:78984626-78984648 TCTGGGGTAGAGGAGGAATAGGG - Intronic
957383667 3:79467705-79467727 CCTGGCATCCAGGAAGAATCAGG - Intronic
957586512 3:82139321-82139343 TCTGGCATCCAGGAAGAATCAGG + Intergenic
957614093 3:82506050-82506072 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
957824476 3:85422980-85423002 TCCTGCGTCCAGGAAGAATCAGG + Intronic
957977112 3:87460775-87460797 CCTGGGGTCCTGAAAAAATCTGG + Intergenic
958023654 3:88026173-88026195 TCTGGCATCCAGGAAGAAAAAGG + Intergenic
958023967 3:88028526-88028548 TTGGGCATCCAGGAAGAATCAGG - Intergenic
958032329 3:88127021-88127043 TCTGGGGTTCAGGAATGATATGG - Intronic
959065192 3:101648885-101648907 TCCAGCGTCCAGGAAGAATCAGG + Exonic
959155712 3:102664108-102664130 TCTGGCATCCAGGAAGAATCAGG - Intergenic
959378033 3:105608806-105608828 TCTGGCGTCCAGGAAGAATCAGG - Intergenic
959389682 3:105759036-105759058 TCCCGTGTCCAGGAAGAATGAGG + Intronic
959449275 3:106479891-106479913 TCTAGGGCTCAGGAAGAATTTGG + Intergenic
959774005 3:110134923-110134945 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
960358192 3:116678862-116678884 TTGGGCGTCCAGAAAGAATCAGG - Intronic
960359776 3:116697523-116697545 TTTGGCATCTAGGAAGAATCAGG + Intronic
960395419 3:117131258-117131280 TCTGGTGTCCAGGAAGAATCAGG - Intronic
960508950 3:118525523-118525545 TCCGGAGACCAGGAAGAATCAGG + Intergenic
960621136 3:119637854-119637876 CCTGGGGCCTAGGAAGACTCAGG - Intronic
960634186 3:119767735-119767757 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
960737731 3:120799007-120799029 TCTGCTGACCAGGAAGAAGCCGG + Intergenic
960963498 3:123089114-123089136 TCTGGGGCCCAGCCAGAAGCTGG + Intronic
961598906 3:128043424-128043446 TCTGGCATCCAAGAAGAATGAGG + Intergenic
962082921 3:132159552-132159574 TCTGGGGTTTAGGAAGAATGAGG + Intronic
962388116 3:134949276-134949298 TCTGGGGTCCAGGAGGACCCTGG + Intronic
962474373 3:135742455-135742477 TCTGGCATCCAAGAAGAATGAGG - Intergenic
962687699 3:137863281-137863303 TCTGGTGTCCAGGAAGGATCAGG - Intergenic
962763793 3:138542788-138542810 TCCTGTGTCCAGGAAGAATGAGG + Intronic
962824474 3:139088045-139088067 TCTTGTGCCCAGGAAGAATGAGG + Intronic
963410555 3:144921987-144922009 TCTGGCATCCAGGAAAAATGAGG + Intergenic
963475620 3:145799909-145799931 TATGGGGTCCAAGATGAATTTGG - Intergenic
963523128 3:146380929-146380951 CCTGGTGTCCAAGAAGAATGAGG + Intergenic
963534868 3:146514682-146514704 TCCGGTGTCCAGGAAAAATGTGG - Intergenic
963655916 3:148049803-148049825 TCTGGCATCCAGTAAGAATCAGG - Intergenic
964136558 3:153351437-153351459 TCTAGCATCCAGGAAGAATCAGG + Intergenic
964247157 3:154666940-154666962 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
964247470 3:154670065-154670087 TTTGGCATCCAGGAAGAATCAGG - Intergenic
964927241 3:161974663-161974685 TCTTGTGTTCAGGAAGAATGAGG + Intergenic
965013973 3:163131966-163131988 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
965085339 3:164088847-164088869 TCCAGCCTCCAGGAAGAATCAGG - Intergenic
965103632 3:164333536-164333558 TCTGGCATCCAAGAAAAATCAGG + Intergenic
965206105 3:165720421-165720443 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
965299704 3:166994729-166994751 TCTGGCATCTAGGAAGAATGAGG + Intergenic
965541486 3:169875717-169875739 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
966095506 3:176196463-176196485 TCTGGCATCCAGGAGGAATCAGG + Intergenic
966256194 3:177918500-177918522 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
966520382 3:180868253-180868275 TTTGGCATCCAGGAAGAATTAGG + Intronic
966520688 3:180870304-180870326 TCCGGCGTCCAGGAAGAATTAGG + Intronic
966816377 3:183893233-183893255 TCTGTGATCCAGGCAGGATCTGG - Intergenic
966854220 3:184183351-184183373 GCTGGGGTCCTGAAAGAAGCTGG - Intronic
966990974 3:185229836-185229858 TCTGGAGTCCTGCAAGAATCAGG + Intronic
967139110 3:186538659-186538681 TTTGGGCCCCAGGAAGAATATGG + Exonic
967751501 3:193121221-193121243 TGTTGCGTCCAGGAAAAATCAGG + Intergenic
1202739394 3_GL000221v1_random:39964-39986 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
1202741867 3_GL000221v1_random:63307-63329 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
968413151 4:406431-406453 GCTGTAGTCCAGGAATAATCAGG + Intergenic
968442538 4:631288-631310 TCTGAGATCCAGGAAGAAACTGG + Intronic
968598545 4:1497983-1498005 TCGGGCATCCAGGAAGAATCAGG + Intergenic
969179285 4:5424703-5424725 TCCTGTGTCCAGGAAGAATGAGG - Intronic
969293227 4:6253660-6253682 CCTGGGGTGCAGGAAGGAGCAGG - Intergenic
969497618 4:7535054-7535076 CCTGGGGTCCAACAGGAATCAGG - Intronic
970013356 4:11484833-11484855 TCTGGGGTGCAGGGAGATTTTGG - Intergenic
970046661 4:11861939-11861961 TCTGGCATCCAGGAAGAATCAGG - Intergenic
970081531 4:12292344-12292366 TCCAGCATCCAGGAAGAATCAGG - Intergenic
970364487 4:15344509-15344531 ACTGAGGTCCATGTAGAATCTGG - Intronic
970578480 4:17451205-17451227 TTCGGTATCCAGGAAGAATCAGG + Intergenic
970612975 4:17742805-17742827 TCTGGTGTCCAGGAAGAATCAGG - Intronic
970943338 4:21661272-21661294 TCCAGTGTCCAGGAAGAATCAGG - Intronic
971005490 4:22370095-22370117 TCAGGCGTCCAGGAGGAATGAGG - Intronic
971427316 4:26529418-26529440 TCCTGCATCCAGGAAGAATCAGG + Intergenic
971502040 4:27328274-27328296 TCTGGCATCCAGGAAGAATTAGG + Intergenic
971669768 4:29542295-29542317 TCTCATGTCCAGGAAGAATGAGG + Intergenic
971730303 4:30370471-30370493 TTTGGCATCCAGGAAGAATCAGG - Intergenic
971767398 4:30850758-30850780 TCTGGGGACTAGGAATAAGCAGG - Intronic
971787486 4:31123719-31123741 TCCAGCGTCCAGGAAGAACCAGG + Intronic
971876788 4:32318541-32318563 TCTCATGTCCAGGAAGAATGAGG + Intergenic
972071039 4:35019697-35019719 GCTGTGGTCCAGGAATAATCAGG + Intergenic
973193109 4:47409280-47409302 TCTGGAGTCCAGGAAGAATCAGG + Intronic
973253574 4:48085901-48085923 TATGGCATCCAGGAAGAATCAGG - Intronic
973362441 4:49177855-49177877 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
973369399 4:49233774-49233796 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
973391638 4:49561642-49561664 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
973398659 4:49619006-49619028 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
974174963 4:58309908-58309930 TCTGGTGTCCAGGAAGAATGAGG + Intergenic
974344588 4:60662420-60662442 TCTGACATCCAGGAATAATCAGG + Intergenic
974368621 4:60985602-60985624 TCTGACATTCAGGAAGAATCAGG + Intergenic
974673278 4:65058436-65058458 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
974978106 4:68917387-68917409 TCCAGCATCCAGGAAGAATCAGG + Intergenic
974987147 4:69042106-69042128 TCCAGGATCCAGAAAGAATCAGG - Intronic
975008544 4:69321186-69321208 TCTTGTGACCAGGAAGAATGAGG - Intronic
975213829 4:71731223-71731245 TCTGGCCTCCAGGAAGAATCAGG - Intergenic
975246977 4:72130868-72130890 TCTGGCATTCAGGAAGAATCAGG + Intronic
975597725 4:76066268-76066290 TCCTGCGTCCAGGAAGAATGAGG + Intronic
975707049 4:77121794-77121816 TCCAGCATCCAGGAAGAATCAGG + Intergenic
975707769 4:77128029-77128051 TTCGGTGTCCAGGAAGAATCAGG + Intergenic
975915902 4:79325343-79325365 CCTGGGCTCCAGGGAGAACCAGG - Exonic
976675408 4:87697383-87697405 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
976802330 4:89006696-89006718 TCTGGCAACCAGGAAGAGTCAGG + Intronic
976815792 4:89147895-89147917 TCCTGTGTCCAGGAAGAATAAGG + Intergenic
976922620 4:90457426-90457448 TCTTGTTTCCAGGAAGAATGAGG + Intronic
977254701 4:94727753-94727775 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
977357862 4:95969416-95969438 TCCAGCATCCAGGAAGAATCAGG - Intergenic
978579783 4:110220333-110220355 TCCGGTGTCCAGGAAGAATCAGG + Intergenic
979297979 4:119054405-119054427 TCCGGCGTCCAGGAAGAATGAGG + Intronic
979716467 4:123844604-123844626 TCTGGCATCCAGGAGGAATGAGG + Intergenic
979727587 4:123982754-123982776 TCTGGCATCCGGGAAGAATCAGG + Intergenic
979728420 4:123992340-123992362 TCTGGCATCCAGGATGAATCAGG - Intergenic
979846740 4:125523009-125523031 TCTGACATCCAGGAAGAATCAGG - Intergenic
979858530 4:125664732-125664754 TCTGGTGTCCAGGAGAAATGAGG + Intergenic
980215193 4:129843694-129843716 TCTGTGGTCCAAGAAGAAATTGG + Intergenic
980264223 4:130494189-130494211 TGTGGGGTACAAGAAGAAACAGG + Intergenic
980299717 4:130972997-130973019 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
980481250 4:133390305-133390327 TCTTGGGACCAAGAGGAATCAGG - Intergenic
980492921 4:133552713-133552735 TCTGGCATCCAGGAAAAATAAGG + Intergenic
980534098 4:134092472-134092494 TCTGGTATCCAGGAAGTATCAGG - Intergenic
980554629 4:134387144-134387166 TCCAGAGTCCAGGAAGAATCAGG - Intergenic
980745010 4:137001441-137001463 TCTTGCATCCAGGAAGAATGAGG - Intergenic
981297320 4:143147031-143147053 TCTGGTGTCCAGGAGTAATGAGG - Intergenic
981362792 4:143866644-143866666 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981373521 4:143987444-143987466 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981382623 4:144090715-144090737 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981597651 4:146445648-146445670 TCAGGCGTCCAGGAAAAATCAGG + Intronic
982325791 4:154127182-154127204 TTTAGTGTCCAGAAAGAATCAGG + Intergenic
982611108 4:157575167-157575189 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
982879848 4:160699942-160699964 TCTTGGGTGAAGGAAGAAGCAGG - Intergenic
982959824 4:161822775-161822797 TCTCACGTCCAGGAAGAATGAGG + Intronic
983000521 4:162408837-162408859 TCTTGCGTCCAGGAAGAATGAGG + Intergenic
983018118 4:162640164-162640186 TCTGGAGTCCAGGAAAAATGAGG - Intergenic
983070077 4:163257308-163257330 TCTGGCATCCAAGAAGAATCAGG + Intergenic
983462639 4:168047026-168047048 TCTGGTGTCCTGGAAAAATGAGG + Intergenic
983810176 4:172051381-172051403 TCTGGAATCCAGGAAGAATCAGG + Intronic
984047038 4:174814214-174814236 GATGGCATCCAGGAAGAATCAGG + Intronic
984129527 4:175856610-175856632 TCCAGCATCCAGGAAGAATCAGG + Intronic
984245331 4:177268577-177268599 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
984292059 4:177808123-177808145 TCTGGTGTCCAGGAGGGATGAGG + Intronic
984373686 4:178899780-178899802 TCCGATATCCAGGAAGAATCAGG + Intergenic
984382914 4:179017820-179017842 TTCAGAGTCCAGGAAGAATCAGG - Intergenic
984417237 4:179477296-179477318 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
985269926 4:188184130-188184152 TCTAGCTTCCAGGAAGAATCAGG - Intergenic
985273795 4:188218813-188218835 TTTGGGGTACCTGAAGAATCGGG + Intergenic
1202759778 4_GL000008v2_random:99328-99350 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1202766512 4_GL000008v2_random:153284-153306 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
985497389 5:217237-217259 TCTGAAGTGCAGGTAGAATCAGG + Intronic
985626563 5:991918-991940 TGTGGGGAGCAGGAAGTATCTGG - Intergenic
985738196 5:1597725-1597747 TCTGAAGTGCAGGTAGAATCAGG - Intergenic
985752917 5:1692626-1692648 TCTGGTGTCCAGGAGGAATGAGG + Intergenic
986093933 5:4537566-4537588 TCCAGCATCCAGGAAGAATCAGG - Intergenic
986588718 5:9346379-9346401 TCTGGTGTCCAGGAAAAATGAGG - Intronic
986924994 5:12735775-12735797 GGTGGGTTCCAGGAAGACTCTGG + Intergenic
987190209 5:15469851-15469873 TCCAATGTCCAGGAAGAATCAGG + Intergenic
987268303 5:16278778-16278800 TTTGGCATCCAGGAAGAATCAGG - Intergenic
987504815 5:18754276-18754298 TCTGGCATCCAGGAAAAGTCAGG + Intergenic
987715040 5:21557647-21557669 TTCGGGGTCCAGAAAGAATCAGG + Intergenic
987926579 5:24350120-24350142 CCCGGTGTCCAGGAAGAATCAGG + Intergenic
988019448 5:25605301-25605323 TCTGAGGACCAAGAAGAATAAGG + Intergenic
988037895 5:25851641-25851663 ACTGGTGTCCAGGAAGGATCAGG + Intergenic
988231349 5:28483744-28483766 TTCAGTGTCCAGGAAGAATCAGG + Intergenic
988776541 5:34482396-34482418 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
988922826 5:35960716-35960738 TCTGGCATCCAGAAAGAACCAGG + Intronic
989161269 5:38393882-38393904 TCCGGTGTCCAGGAAGAATCAGG + Intronic
989505051 5:42217401-42217423 TCTAGCATCTAGGAAGAATCAGG + Intergenic
989558612 5:42825684-42825706 TCTAGCATCCAGGAAGAATCAGG - Intronic
989615075 5:43330857-43330879 GCTGTAGTCCAGGAATAATCAGG + Intergenic
989719141 5:44504106-44504128 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
990079829 5:51899407-51899429 TCTGGTGACCAGGAAGAATCAGG + Intergenic
990463167 5:56048046-56048068 TCCAGCATCCAGGAAGAATCAGG - Intergenic
990463797 5:56053491-56053513 TCTGGCATCCAGGAAGAATCAGG - Intergenic
990507251 5:56456884-56456906 TGTGGGACCCAGGAAGAAGCAGG + Intergenic
990798361 5:59570283-59570305 TCAGAGGTCCAGAAAGTATCAGG - Intronic
990923412 5:60993453-60993475 TCCTGAGTCCAGGAAGAATGAGG + Intronic
991082316 5:62614807-62614829 TCTGGCATCCAGGAAGAATCAGG + Intronic
991207467 5:64065985-64066007 TCTAGTGTCCAGGAAGAATCAGG - Intergenic
991644975 5:68792568-68792590 TCCGGTGTCCAGAAAGAATCAGG + Intergenic
992160077 5:73992574-73992596 TCTGGCATCCAGGAAGTATCAGG + Intergenic
992226067 5:74620690-74620712 TCTGGTGTCCAGGAAGAATCCGG + Intergenic
992637141 5:78735840-78735862 TCTGTCATCCAGGAAGAATCAGG - Intronic
992992471 5:82298338-82298360 TTTGGCATCCAGGAAGAATCAGG + Intronic
994209621 5:97073409-97073431 TCCAGCATCCAGGAAGAATCAGG - Intergenic
994533189 5:100992794-100992816 TCCAGCATCCAGGAAGAATCAGG + Intergenic
994641007 5:102410061-102410083 TCCTGTGTCCAGGAAGAATGAGG + Intronic
994753165 5:103763924-103763946 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
994762803 5:103878128-103878150 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
994898841 5:105744424-105744446 TCTGGTGTCCAGGAGGAATGAGG - Intergenic
994999075 5:107104414-107104436 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
995494466 5:112726244-112726266 TCTGGCATCCAGGAAGATTCAGG + Intronic
995533660 5:113114878-113114900 TTTGGCATCCAGGAAAAATCAGG - Intronic
995638137 5:114219345-114219367 TCTGGTATCCAGGAAAAATGAGG + Intergenic
995844863 5:116482471-116482493 ACTGGTGTCCAGGTGGAATCAGG + Exonic
995894590 5:116997772-116997794 GCTGAGCTCAAGGAAGAATCTGG + Intergenic
996101502 5:119449971-119449993 TTTGGCATCCAGGAAAAATCAGG + Intergenic
996502283 5:124230375-124230397 TCTGGCATCCAGGAGGAATGAGG - Intergenic
996557896 5:124797748-124797770 TCTGGTGCCCAAGAAGAATGAGG - Intergenic
996710093 5:126535404-126535426 TCCGGCATCCAGGAAGAATCAGG + Intergenic
996761121 5:126986906-126986928 TCTGGAGGCCAGGAAGAAGATGG + Intronic
996890317 5:128411334-128411356 TCTGGTGTCCAGGGAGAATCAGG + Intronic
997318132 5:132954958-132954980 TCCGGTATCCAGGAAGAATCAGG + Intronic
997526104 5:134554276-134554298 TCTGGGGTCTTCGGAGAATCAGG + Intronic
997717476 5:136052885-136052907 TCTGGGGTCCAAACAGACTCAGG - Exonic
998750732 5:145318827-145318849 TCTGGCATCCAGGGAAAATCAGG + Intergenic
998791182 5:145767416-145767438 TCCTGCATCCAGGAAGAATCAGG - Intronic
998868540 5:146529945-146529967 TCTGGCATCCAGGAAGAATCAGG - Intergenic
999799345 5:155019070-155019092 TCCAGCGTCCAGGAAGAATGAGG + Intergenic
999863963 5:155680045-155680067 TTCGGTGTCCAGGTAGAATCAGG - Intergenic
999954068 5:156681160-156681182 TCCGGCGTTCAGGAAGAATCAGG + Intronic
1000100074 5:158007840-158007862 TTCGGTTTCCAGGAAGAATCAGG - Intergenic
1000155799 5:158550223-158550245 TCAGGGGCCCAAGAAGATTCTGG - Intergenic
1000233477 5:159336350-159336372 TTTGGTGTCCAGGAAAAATCAGG - Intergenic
1000234429 5:159344466-159344488 TCCTATGTCCAGGAAGAATCAGG + Intergenic
1000426272 5:161094225-161094247 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1000742528 5:164987319-164987341 TCCGGCCTCCAAGAAGAATCAGG - Intergenic
1000852863 5:166362036-166362058 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1000949402 5:167462458-167462480 TCCAGCGTCCAGGAAGAATCAGG + Intronic
1001225129 5:169937779-169937801 TCTAGGGTCCAGGGACAATGAGG - Intronic
1001354210 5:171004310-171004332 GCTGCAGTCCAGGAATAATCAGG + Intronic
1001616553 5:173047702-173047724 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1001891764 5:175345316-175345338 ACTGGGGTCAAAGAAGATTCAGG + Intergenic
1002604754 5:180375925-180375947 TCTGTTGTCCAGGGAGACTCAGG + Intergenic
1002762671 6:214138-214160 TCCCATGTCCAGGAAGAATCAGG - Intergenic
1003072670 6:2957255-2957277 TAAGGGGTCCAGGAGGAAGCTGG + Intronic
1003152187 6:3562273-3562295 TCTGGGGCTCAGGAAGACCCAGG + Intergenic
1003193999 6:3898918-3898940 TTTGGTGTCCAGGAAGAATTAGG + Intergenic
1003254179 6:4459899-4459921 TCTGGGAAACAGGAAGAGTCGGG + Intergenic
1003511943 6:6789014-6789036 TCTGGGGAGCAGGAAGAATTGGG + Intergenic
1003687842 6:8322552-8322574 TCCAATGTCCAGGAAGAATCAGG + Intergenic
1003783107 6:9451534-9451556 TCCAGCGTCCAGGAAAAATCAGG - Intergenic
1004495136 6:16155939-16155961 TTTGGTGTCCAGGAAAAATCAGG + Intergenic
1004906110 6:20238709-20238731 AGTGGCATCCAGGAAGAATCAGG + Intergenic
1004977497 6:20984544-20984566 TCTGGCTTCCAGGAGGAATGAGG + Intronic
1006110841 6:31744218-31744240 TCCTGGGTCGAAGAAGAATCGGG + Exonic
1006621754 6:35370189-35370211 TCTGTGGGCCAGGAAGGGTCTGG + Intronic
1006934588 6:37708446-37708468 TCTAGGGTCACAGAAGAATCTGG - Intergenic
1007174883 6:39888847-39888869 TCTTGGGTCAAGGAGAAATCAGG + Intronic
1007932055 6:45700408-45700430 TTTGGTGGCCAGAAAGAATCAGG - Intergenic
1008025237 6:46628671-46628693 TCTGGGCTCCAGGAAAAGACAGG + Intronic
1009001683 6:57724397-57724419 TTCGGGGTCCAGAAAGAATCAGG - Intergenic
1009305412 6:62083416-62083438 TCTGGCATCCAGGAGGAATCAGG - Intronic
1009349892 6:62661284-62661306 TCTTGCATCCAGGAAGAATCGGG + Intergenic
1009404069 6:63291321-63291343 TCCGGAGTCCAGGAAGAAACAGG + Intronic
1009627927 6:66160772-66160794 TTTGGGGTTCAGGAAAACTCAGG + Intergenic
1009948185 6:70364368-70364390 TGTGGCGTCCAGGAGGAATGAGG + Intergenic
1010254502 6:73742505-73742527 TCTGGGAGCCAGGAGGCATCTGG + Intronic
1010327516 6:74581979-74582001 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1010494203 6:76513729-76513751 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1010634413 6:78239971-78239993 TCTGGCGTCCAGGAAGAATTAGG - Intergenic
1011353313 6:86446797-86446819 TCCAGCATCCAGGAAGAATCAGG + Intergenic
1011491808 6:87900657-87900679 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1011510324 6:88093475-88093497 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1011899516 6:92275005-92275027 TCTGGGGTCCAGGAGGAATGAGG + Intergenic
1012769026 6:103405192-103405214 CCTGGCATCCGGGAAGAATCAGG + Intergenic
1012843188 6:104356080-104356102 TCTGGTGTCCAGAAAAAATGAGG - Intergenic
1012936755 6:105376159-105376181 GTTGGGGTCCAGGAACACTCTGG + Exonic
1012950493 6:105512984-105513006 TGTGGGGTTCAGGAAGACTGAGG + Intergenic
1013086313 6:106860915-106860937 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
1013670705 6:112399526-112399548 TCTCGAGTCCAAGAAGAATGAGG + Intergenic
1014107420 6:117582818-117582840 TCTGGTGCCCACGAAGAATGAGG - Intronic
1014252192 6:119126756-119126778 TCTGGCATCCAGGAAAAATCAGG + Intronic
1014505299 6:122247740-122247762 TCTTGTGTCCAGGAAGAATGAGG + Intergenic
1014635612 6:123843224-123843246 TCCAGAATCCAGGAAGAATCAGG + Intronic
1014740494 6:125143359-125143381 TCTGGTGTCCAAGAAGAATTAGG + Intronic
1014770536 6:125453764-125453786 TCCCGTGTCCAGGAAGAATGAGG - Intergenic
1014992836 6:128103331-128103353 TCTGGTGTCCAGGAAGAATCAGG - Intronic
1015042885 6:128742902-128742924 TCTGGCATCCAGGAAGAAACAGG - Intergenic
1015194460 6:130510234-130510256 TTTGGCGTCCGGGAAGAATCAGG + Intergenic
1015278253 6:131405606-131405628 GCTGTAGTCCAGGAATAATCAGG - Intergenic
1015790427 6:136959461-136959483 TCTGGCATCCAGGAAAAATGAGG - Intergenic
1015932431 6:138375027-138375049 TCTGGTGCCCAAGAAGAATGAGG + Intergenic
1016076702 6:139804740-139804762 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1016533970 6:145090535-145090557 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1016569092 6:145492552-145492574 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1016685291 6:146874572-146874594 TCTTGGGTCCAGGAAGGCTTTGG - Intergenic
1016902163 6:149113583-149113605 CCTTGCATCCAGGAAGAATCAGG - Intergenic
1017221330 6:151969139-151969161 TCTGGCTTCCAGGAAGAACCTGG + Intronic
1017584870 6:155909486-155909508 TCTGGCGTACAGGAAAAATGAGG - Intergenic
1017587988 6:155947669-155947691 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1017633593 6:156422755-156422777 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1017782376 6:157725887-157725909 TTTGGTGTTCGGGAAGAATCAGG - Intronic
1017782513 6:157727139-157727161 GCTCGGTTCCAGGAACAATCTGG - Intronic
1017922728 6:158885949-158885971 GCTGTAGTCCAGGAATAATCAGG + Intronic
1018064899 6:160118037-160118059 TCCTGCGTCCAGGAAGAATAAGG + Intergenic
1018497045 6:164359319-164359341 TCTAGCATCCAGGAAGAATCAGG + Intergenic
1018803102 6:167238430-167238452 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
1018831070 6:167444023-167444045 TCCAGCGTCCAGGAAGAATCGGG + Intergenic
1018889346 6:167972132-167972154 GCTGGGATCAAGGAAGCATCAGG - Intergenic
1019042328 6:169117559-169117581 TCTGATGTCCAGGAGGAATGAGG - Intergenic
1019696109 7:2446983-2447005 TCTGGGGTCCTGGAGGCTTCTGG + Intergenic
1019801146 7:3089312-3089334 TCTGGGGACCAGCAGGAAGCAGG + Intergenic
1019897857 7:3997231-3997253 TCTTGTATCCAGGAAGAATAAGG + Intronic
1020025190 7:4894819-4894841 TTCCGTGTCCAGGAAGAATCAGG + Intergenic
1020362954 7:7349548-7349570 ACTGGAGTCCAGGAAGACTAAGG - Intergenic
1020586839 7:10079426-10079448 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1020990722 7:15192562-15192584 TCCAGTGTCCGGGAAGAATCAGG - Intergenic
1021167599 7:17360058-17360080 TCTGACATCCAGGAAGAATCAGG + Intergenic
1021179962 7:17494750-17494772 TCCAGCGTCCAGGAAGGATCAGG - Intergenic
1021420800 7:20443014-20443036 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1021560522 7:21964831-21964853 TCCGGAGTCCAGGAAGAATCAGG - Intergenic
1022196738 7:28075313-28075335 TCTGTGGTCCAGGAGGAGTGGGG - Intronic
1023500475 7:40844305-40844327 TCCAGTGTCCAGGAAGAATCAGG + Intronic
1023789193 7:43738211-43738233 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1024051079 7:45623872-45623894 TCTGGGGTCCAAGGAAACTCGGG - Intronic
1024173112 7:46810599-46810621 TCAGGCGTTCAGGAAGAATCAGG + Intergenic
1025003411 7:55337064-55337086 TCCGGCATCCAGGAAGAGTCAGG + Intergenic
1025849350 7:65233322-65233344 TCTGGCATCCAGGAGGAATGAGG - Intergenic
1026108108 7:67437046-67437068 TCTGGGGTCCAGTGATAATCCGG - Intergenic
1026127080 7:67588419-67588441 TCTTGGTTCCAGGAAGCATAAGG - Intergenic
1026359537 7:69591005-69591027 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1026562066 7:71458583-71458605 CCTGGTGTCCAGGAAGAATCAGG + Intronic
1026674864 7:72419983-72420005 TTCAGTGTCCAGGAAGAATCAGG - Intronic
1027521665 7:79216366-79216388 TCTGGCATCCAGGAAAAATCAGG - Intronic
1027569571 7:79847329-79847351 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1027585214 7:80049111-80049133 TTGGGCATCCAGGAAGAATCAGG + Intergenic
1027706160 7:81536001-81536023 TCCAGGATCCAGGAAGAATCAGG - Intergenic
1027708534 7:81567256-81567278 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1027840218 7:83300406-83300428 TCTGGGAGTAAGGAAGAATCTGG + Intergenic
1027888336 7:83937899-83937921 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1028046830 7:86130776-86130798 TCTGGCTTCCAGGAAAAATGAGG + Intergenic
1028401903 7:90433599-90433621 TCTCATGTCCAGGAAGAATGAGG + Intronic
1028530379 7:91831920-91831942 TCCGGCGTCCAGGAAGAATCAGG + Intronic
1028531411 7:91842464-91842486 TCTGGTGTCCAGGAAGAATCAGG - Intronic
1028640833 7:93040174-93040196 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1028872268 7:95782704-95782726 TCCGGCATCCAGGAAGAATCAGG + Intronic
1029016139 7:97316870-97316892 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1029017037 7:97325724-97325746 TCCAGCATCCAGGAAGAATCCGG + Intergenic
1029017297 7:97327600-97327622 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1029493379 7:100884293-100884315 TCTGGGGATCAGGTAGAAGCCGG + Intronic
1030188855 7:106790916-106790938 TCTGTGGTCCAGGTGTAATCAGG + Intergenic
1030387183 7:108878302-108878324 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1030688432 7:112509255-112509277 TCTGGTGTCCAGGAAGAAACAGG + Intergenic
1030756388 7:113292004-113292026 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1030991362 7:116304836-116304858 GCTGGGGGTCAGGAAGTATCAGG + Intronic
1031116394 7:117673437-117673459 TCTGGCGTCCAGAAAAAATGAGG - Intronic
1031514296 7:122683052-122683074 TCTGGCGTCCAGGAAGAATCAGG + Intronic
1031693466 7:124818822-124818844 TTTGGAGTCCAGGAAGAATCAGG - Intergenic
1031782414 7:125985332-125985354 TCCGGCATCCAGGAAGAATCAGG - Intergenic
1031786650 7:126041386-126041408 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1031821030 7:126501806-126501828 AATGGGGTCCAGGAAGAGTCGGG + Intronic
1031916880 7:127571709-127571731 TCTGGGGAACAGGAAGACACTGG + Intergenic
1032612461 7:133430062-133430084 TCTAGCATCCAGGAAGAATCAGG + Intronic
1032858557 7:135857654-135857676 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1032917575 7:136509769-136509791 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1033586891 7:142780739-142780761 GGTGGGGACAAGGAAGAATCAGG - Intergenic
1033633814 7:143189379-143189401 TTGGGCATCCAGGAAGAATCAGG + Intergenic
1033724408 7:144098409-144098431 TCTTGGTTTCAGGAAGAATGTGG - Intergenic
1033767111 7:144505937-144505959 TCTGGCATCCAGGAAGAATCAGG - Intronic
1033857160 7:145577785-145577807 TCTGGCTTCCAGGAGGAATCAGG + Intergenic
1033881286 7:145887060-145887082 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1033976029 7:147101554-147101576 TCTGGCATTCAGAAAGAATCAGG + Intronic
1034095547 7:148404729-148404751 TCTGGCATCCAGGAAGAATCAGG + Intronic
1034099376 7:148437912-148437934 TCTGGCATCCAGGAAGAATCGGG + Intergenic
1034210351 7:149357792-149357814 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034215872 7:149405169-149405191 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034406357 7:150905394-150905416 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034998079 7:155590973-155590995 TCCAGTGCCCAGGAAGAATCAGG + Intergenic
1035061326 7:156071682-156071704 ACTTGGGTCCAGGCAGAATGAGG + Intergenic
1035184002 7:157111707-157111729 TCTGGCGCCCAGGAGGAATGAGG + Intergenic
1035370370 7:158375965-158375987 TCTGGCGTCCAGGAAGAATCAGG - Intronic
1035560179 8:598423-598445 TCTGGGATCCAGGAAGAAGAGGG - Intergenic
1035824379 8:2628991-2629013 TCTGACATCCAGGAAGAATCAGG + Intergenic
1035824665 8:2631576-2631598 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1035884661 8:3279055-3279077 TCTGGGAACCAGTGAGAATCGGG - Intronic
1036022543 8:4862126-4862148 TCTGGGGACAAGGAGGCATCAGG + Intronic
1036680493 8:10869257-10869279 TATGGGGTCCAGTGAGAGTCTGG + Intergenic
1036824690 8:11966983-11967005 TCAGTGGCTCAGGAAGAATCAGG + Intergenic
1038149387 8:24928655-24928677 TCTTGTGTACAGGAAGAATGAGG - Intergenic
1038215965 8:25561993-25562015 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1039306316 8:36267239-36267261 TCTGGCATCCAGAAAGAATCAGG + Intergenic
1039645501 8:39277987-39278009 TCTGGCATCCAGGAAAAATGAGG + Intronic
1041216684 8:55607937-55607959 TATGGAGTCCAGGAAGAATCAGG - Intergenic
1041506009 8:58598663-58598685 TCTTGGGGCCAGGATGAATTTGG + Intronic
1041965425 8:63669892-63669914 TCTCATGTCCAGGAAGAATGAGG + Intergenic
1041992118 8:64005918-64005940 CCTGGGGTCCAGCATGAATGAGG - Intergenic
1042077859 8:65015875-65015897 TTTGTCATCCAGGAAGAATCAGG + Intergenic
1042238717 8:66640873-66640895 TCTGGCATCCAGGAAGAATCAGG - Intronic
1042240806 8:66662335-66662357 TCTGGGGTTCATGAAAATTCTGG - Intronic
1042336988 8:67639782-67639804 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1042601427 8:70503099-70503121 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1042819707 8:72916644-72916666 TCTGGCATCCAGGAGGAATGAGG + Intronic
1042839957 8:73113639-73113661 TCTGGGGAAAAGGAAGAATCAGG - Intronic
1043077521 8:75720388-75720410 TCTGGCATCCAGGAGAAATCAGG - Intergenic
1043220468 8:77655902-77655924 TCTAGCATCCAGGAAGAATCAGG - Intergenic
1043702021 8:83300898-83300920 TATGGTATCCAGGAAGAAACAGG - Intergenic
1043815087 8:84792188-84792210 TCCAGCATCCAGGAAGAATCAGG + Intronic
1044022825 8:87128183-87128205 TTCGGCTTCCAGGAAGAATCAGG - Intronic
1045392048 8:101725485-101725507 TTTGGCATCCAGGAAGAATCAGG - Intronic
1046396841 8:113651233-113651255 CCTGGCATCCAGGAAGAATCAGG - Intergenic
1046398770 8:113676328-113676350 TCTGGCATCCAGGAAAAATTAGG - Intergenic
1047108680 8:121764266-121764288 TTTGGGGTCCATGAAGCATTAGG + Intergenic
1047113804 8:121818612-121818634 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1047878842 8:129170335-129170357 TCTGGTGTCCATGAGGAATGAGG - Intergenic
1048325697 8:133437216-133437238 CCTGGGGTCCAAGGAGAAACAGG + Intergenic
1048439622 8:134450396-134450418 TCCAGTGTCCAGGAGGAATCCGG - Intergenic
1048680083 8:136831763-136831785 CCCAGTGTCCAGGAAGAATCAGG + Intergenic
1048900349 8:139031648-139031670 TCCGGCATCCAGGAAGAATCAGG + Intergenic
1049140543 8:140950147-140950169 TCCAGTGTCCAGGAAGAATGAGG - Intronic
1049409945 8:142468512-142468534 GCTGTGGTCCTGGAAGCATCAGG - Intronic
1049670499 8:143867422-143867444 GCAGGGGTCCAGGAGGAACCCGG + Exonic
1049728307 8:144161794-144161816 TCCGTCGTCCAGGAAGAAACGGG - Intronic
1050237553 9:3597752-3597774 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
1050330442 9:4540332-4540354 TTTGGTGTCCAGGAATAATCAGG - Intronic
1050593891 9:7186795-7186817 TAGGGGCTCTAGGAAGAATCTGG + Intergenic
1050803515 9:9644942-9644964 TGTGGCATCCAGGAAGAATCAGG - Intronic
1051263494 9:15288626-15288648 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1052113449 9:24618995-24619017 TCTGGCATCTGGGAAGAATCAGG + Intergenic
1052289290 9:26823838-26823860 TCTGGCATCTAGGAAGAATCAGG + Intergenic
1052459767 9:28747411-28747433 TCCAACGTCCAGGAAGAATCCGG - Intergenic
1052465906 9:28829334-28829356 TCCGTTGTCCAGGAAAAATCAGG - Intergenic
1052588930 9:30465994-30466016 TCCGGCATCCAGGAAGAATCAGG - Intergenic
1052614879 9:30825529-30825551 TTTGGGGTACAGGAAGAAACTGG - Intergenic
1052691507 9:31821395-31821417 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1052852536 9:33386782-33386804 CGGGGGGCCCAGGAAGAATCTGG + Intronic
1052880731 9:33599696-33599718 TCTGGGGTGCAGGGAGAGGCAGG - Intergenic
1053666954 9:40323508-40323530 TCTGGGGTGCAGGGAGAGGCAGG - Intronic
1053680636 9:40483333-40483355 CGGGGGGGCCAGGAAGAATCTGG + Intergenic
1053916545 9:42948617-42948639 TCTGGGGTGCAGGGAGAGGCAGG - Intergenic
1053930624 9:43111645-43111667 CGGGGGGGCCAGGAAGAATCTGG + Intergenic
1054283076 9:63141602-63141624 CGGGGGGGCCAGGAAGAATCTGG - Intergenic
1054293718 9:63318848-63318870 CGGGGGGGCCAGGAAGAATCTGG + Intergenic
1054378104 9:64463536-64463558 TCTGGGGTGCAGGGAGAGGCAGG - Intergenic
1054391742 9:64623337-64623359 CGGGGGGGCCAGGAAGAATCTGG + Intergenic
1054503985 9:65892991-65893013 CGGGGGGGCCAGGAAGAATCTGG - Intronic
1054517656 9:66052775-66052797 TCTGGGGTGCAGGGAGAGGCAGG + Intergenic
1055156143 9:73065501-73065523 TCCGGCATCCAGGAAGAATCAGG - Intronic
1055449294 9:76416357-76416379 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1055486301 9:76759702-76759724 TCCAGCATCCAGGAAGAATCAGG - Intronic
1056085709 9:83147718-83147740 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1056462211 9:86818843-86818865 TCCCGTGTCCAGGAAGAATGAGG - Intergenic
1056721850 9:89078766-89078788 TCAGGGGTCCAGAAAGGAGCTGG + Intronic
1056986183 9:91365098-91365120 TCCTGGGTCCAGGAAGAATGAGG - Intergenic
1057542782 9:95990847-95990869 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1058093876 9:100837076-100837098 TCTGGCATCGAGGAAGAATAAGG - Intergenic
1058317470 9:103586617-103586639 TCTGGCGTCCAAGAAGAATGAGG - Intergenic
1058318476 9:103599289-103599311 TTTGGCATCCAGGAAAAATCAGG - Intergenic
1058487671 9:105458411-105458433 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1058763057 9:108155032-108155054 TCTGGAGCCCAGAAAGACTCTGG + Intergenic
1059062237 9:111045444-111045466 TTTGGTGTCCAGGGAGAATCAGG - Intergenic
1059852869 9:118363724-118363746 TCTTGAGTCCAGGAAGAATGAGG - Intergenic
1059985077 9:119813620-119813642 TCTGGTGCCCAAGAAGAATGAGG - Intergenic
1061044219 9:128155854-128155876 TCCGGAGTCCAAGAAGAATGAGG - Intergenic
1061182389 9:129032457-129032479 TCTAGTGTCCAAGAAGAATGAGG - Intergenic
1061225597 9:129279193-129279215 GCTGGAGTCCAGAAAGATTCTGG - Intergenic
1061798963 9:133103950-133103972 TCTGGGGTCCAGGGAGACAGTGG - Intronic
1062418619 9:136467201-136467223 GCTGGTTTCCAGGAAGAAGCTGG - Intronic
1062429225 9:136519610-136519632 TCGGGGGTCCAGGCAGGAGCCGG - Intronic
1062638538 9:137504616-137504638 TCAGGGGTCCAGGAACACGCTGG + Intronic
1062674476 9:137732372-137732394 TCTTGGGTCCAGGAAGAATGAGG + Intronic
1062690019 9:137836908-137836930 TCTGGGCTCCTGGAGGAATGCGG - Intronic
1203516018 Un_GL000213v1:2189-2211 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1203691570 Un_GL000214v1:47543-47565 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1203708037 Un_KI270742v1:69913-69935 GCTCAGGGCCAGGAAGAATCTGG - Intergenic
1203710497 Un_KI270742v1:93231-93253 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1203540554 Un_KI270743v1:84223-84245 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1203547267 Un_KI270743v1:138162-138184 GCTCAGGGCCAGGAAGAATCTGG + Intergenic
1203644725 Un_KI270751v1:56648-56670 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1185769769 X:2756976-2756998 TCCAGCATCCAGGAAGAATCAGG + Intronic
1185936026 X:4257799-4257821 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1185950092 X:4422951-4422973 TCTAGGGTCCAGGAAAAATCAGG + Intergenic
1185961774 X:4552514-4552536 TCTGGCATCTAGGAAAAATCAGG + Intergenic
1186031766 X:5376219-5376241 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1186032087 X:5379049-5379071 TCCGGCATCCAGGAAGAATCGGG - Intergenic
1186039218 X:5457641-5457663 TCTGGCATCCAGGGAGAATCTGG + Intergenic
1186056454 X:5654618-5654640 TCTGGTGTCCAGGAAGAATGAGG + Intergenic
1186223574 X:7374873-7374895 TCTCGTCTCCAGGAAGAATGAGG + Intergenic
1186326412 X:8482156-8482178 TCTGGGGTCCCAGAGGAATCAGG + Intergenic
1186436676 X:9549163-9549185 GCTGGGGTCCAGGGAGCAACAGG - Intronic
1187324493 X:18274031-18274053 TCTGGCATCCAGGAGGAATGAGG - Intronic
1188117552 X:26263746-26263768 TCCAGTGTCCGGGAAGAATCGGG + Intergenic
1188188383 X:27144650-27144672 TCTGGTGTCCAGGAGAAATGAGG - Intergenic
1188390342 X:29611722-29611744 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1188437580 X:30179755-30179777 TCCGACATCCAGGAAGAATCAGG - Intergenic
1188526552 X:31094013-31094035 TCTGGCATCCAAGAAGAATCAGG + Intergenic
1188973060 X:36640494-36640516 TCTGGGGCCCAGCAGGAAACAGG + Intergenic
1189083647 X:37998188-37998210 TCTTGTGACCAGGAAGAATGAGG - Intronic
1189259640 X:39669228-39669250 TCTCGGATGAAGGAAGAATCAGG + Intergenic
1189425887 X:40899569-40899591 TCTGGCTTCCAAGAAGAAGCAGG + Intergenic
1190487441 X:50941917-50941939 TCTTGTGTCCAAGAAGAATGAGG + Intergenic
1190566134 X:51732198-51732220 TACAGTGTCCAGGAAGAATCAGG - Intergenic
1190569394 X:51766268-51766290 TTTGAGGTCCAGGAAGAATCAGG - Intergenic
1190569735 X:51769083-51769105 TCTGGTGCCCAAGAAGAATGAGG - Intergenic
1190581840 X:51897640-51897662 CCTGGGGTACAGGAATAATGGGG + Intronic
1190620632 X:52284115-52284137 TCTTGTGTCCAGGAAGAAGGAGG + Intergenic
1191052947 X:56213877-56213899 CCTGGCATCCAGGAAAAATCAGG + Intergenic
1191057232 X:56254550-56254572 TCTGGCATCCAGGAGGAATGAGG + Intronic
1192089740 X:68141012-68141034 TTTGGTGTCCAGGAAGAATCAGG - Intronic
1192285080 X:69727005-69727027 TCTGGCGTTCAAGAAGAATCAGG + Intronic
1193111132 X:77731888-77731910 TCTGGCATCCAAGAAGAATGAGG - Intronic
1193144586 X:78063971-78063993 TCAAGTGTCCAGGAAGAATCAGG + Intergenic
1193486075 X:82086654-82086676 TCTTGTGTCCAAGAAGAATGAGG + Intergenic
1193532630 X:82674718-82674740 TCTGGTGTCCAGAGAAAATCAGG + Intergenic
1193710057 X:84868882-84868904 TCTGGCATCCAGGAAGAATCAGG + Intergenic
1193749552 X:85326057-85326079 CCAGCGGTCCAGGAAGAATTCGG - Intronic
1194163358 X:90483339-90483361 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1194293528 X:92103162-92103184 GCTGTAGTCCAGGAAGAGTCAGG + Intronic
1194364930 X:93003439-93003461 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1194411665 X:93565572-93565594 TTTGCTGTCCAGGAAGAATCAGG + Intergenic
1195454211 X:105050666-105050688 TCCCAGGTCCAGGAAGAATGAGG + Intronic
1195605689 X:106803217-106803239 TCTGAGGCCAAGGAAGAAACGGG + Intronic
1195647544 X:107249658-107249680 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1195853208 X:109305417-109305439 TCTGGCATCTAGGAAGAATGAGG + Intergenic
1195854074 X:109311343-109311365 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1195907054 X:109854450-109854472 TATGGGGTCCAGGAAGTAGAAGG + Intergenic
1196375168 X:115025610-115025632 TCTAGCATCCAGGAAAAATCAGG - Intergenic
1196861582 X:120033761-120033783 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1196883615 X:120223068-120223090 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1197117051 X:122845734-122845756 TCTTGGCTGCAGGAAGAACCAGG + Intergenic
1197527236 X:127577922-127577944 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1198330704 X:135619759-135619781 TCTGGTGCCCAAGAAGAATGAGG + Intergenic
1198336222 X:135669237-135669259 TCTGGTGCCCAAGAAGAATGAGG - Intergenic
1198363409 X:135917416-135917438 TCTGGTGCCCAAGAAGAATGAGG + Intergenic
1198532817 X:137562585-137562607 TCTGGGTTGTAGGAAGAACCCGG + Intergenic
1198613289 X:138425590-138425612 TCCAGTGTCCAGGAAGAATGAGG - Intergenic
1198666783 X:139032933-139032955 TTTGGTGCCAAGGAAGAATCAGG + Intronic
1199092390 X:143706518-143706540 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1199380673 X:147168570-147168592 TCTGGCATCCAGGAAGAATCAGG - Intergenic
1199575664 X:149311621-149311643 TCTGGCATCCAGGGAGAATCAGG + Intergenic
1200411715 Y:2868071-2868093 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1200509627 Y:4061064-4061086 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1200624214 Y:5491466-5491488 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1200673159 Y:6119693-6119715 TCCAGCATCCAGGAAGAATCAGG - Intergenic
1201610701 Y:15839984-15840006 TCTGGCATCCAGGAGGAATGAGG + Intergenic
1201701178 Y:16883802-16883824 TCATGTGTCCAGGAAGAATCAGG + Intergenic
1201751480 Y:17436553-17436575 TCTGGCATCCAGGAAAAATCAGG + Intergenic
1202062181 Y:20899364-20899386 GCTGTAGTCCAGGAATAATCAGG - Intergenic