ID: 1090683817

View in Genome Browser
Species Human (GRCh38)
Location 11:129092597-129092619
Sequence TTGTATATAAATAAGTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090683817 Original CRISPR TTGTATATAAATAAGTAAGA TGG (reversed) Intronic
901588741 1:10321007-10321029 TTATTTTTAAATAAGTGAGATGG + Intronic
903444098 1:23409847-23409869 TTAAATATAAATAAGTAAATTGG - Intronic
903743245 1:25570557-25570579 TTGTATATTAAGAAGTAACCCGG + Intergenic
904562016 1:31405334-31405356 TTGTATATATATACATGAGATGG + Intergenic
904925067 1:34041152-34041174 ATTTATTTAAATAAGGAAGAGGG + Intronic
905934816 1:41815022-41815044 AAGTAAATAAATAAATAAGATGG + Intronic
908001703 1:59686808-59686830 TTTTATACAAATGAGTAAGCAGG - Intronic
908466766 1:64403699-64403721 TTTTAAATAAATAAGTAACAAGG + Intergenic
908896187 1:68902827-68902849 TTTTATATAAAATAGGAAGATGG + Intergenic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
909141001 1:71865141-71865163 TTATAGCTAAATAAATAAGATGG - Intronic
909266897 1:73571093-73571115 TTGTACATAAATAAGCAAGGAGG + Intergenic
909584676 1:77276458-77276480 AGGTACATAAATAAGGAAGAAGG + Intergenic
909754514 1:79207237-79207259 TTCCATATAAATAAATTAGAAGG - Intergenic
910052008 1:82985868-82985890 TTGGATATGAATCAATAAGATGG - Intergenic
910410421 1:86937713-86937735 TTATATATATATAAGGTAGAAGG - Intronic
910736047 1:90458842-90458864 TTTTATAGAATTAAGTAACATGG - Intergenic
911767783 1:101700188-101700210 TGGTATATACAGAAGTAAGCAGG - Intergenic
911882543 1:103259622-103259644 ATGTGTATGAATAAGTAGGAGGG + Intergenic
912063497 1:105704995-105705017 TTCTATAAAAATAAGAAAGTAGG - Intergenic
915029430 1:152864556-152864578 TTGTACAAAAATAAGCAAAATGG - Intergenic
916218013 1:162414666-162414688 TTGAAAATAAACAAGTAAAAGGG + Intergenic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
917588635 1:176454400-176454422 TCGTAAATAAATAAGTGTGAGGG + Intergenic
917729880 1:177864086-177864108 TTTTATATAAATAAATAGAAAGG - Intergenic
918129789 1:181617055-181617077 ATAGATATAAATAAATAAGAGGG - Intronic
918661565 1:187094461-187094483 TTTTATATATATTATTAAGAAGG - Intergenic
919067156 1:192707009-192707031 TTGTATGTAAATAGGTACCATGG - Intergenic
919337559 1:196257455-196257477 ACGTATATAAATATGTAACATGG - Intronic
920612713 1:207457092-207457114 AGGTACATAAATAAGGAAGAAGG - Intronic
922351052 1:224734870-224734892 TTCTGTATAAACAAGTAAGGGGG + Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922956598 1:229607113-229607135 TTGAAAATAAATAAGTCAGAAGG - Intronic
924446794 1:244140341-244140363 TTGTTTACAAATAATGAAGAAGG - Intergenic
1063818240 10:9802312-9802334 ATGAAGATAAATAAGTTAGATGG - Intergenic
1065272057 10:24043978-24044000 TTGTAAATAAATAAATAAACTGG + Intronic
1065530759 10:26667814-26667836 TTGTTTATAAATAATTAAAATGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1067322829 10:45238484-45238506 TTTTATATACATAAGAATGAAGG + Intergenic
1067490305 10:46692720-46692742 TTGTATATAAAAAACTAATGTGG - Intergenic
1067604360 10:47647648-47647670 TTGTATATAAAAAACTAATGTGG + Intergenic
1068385332 10:56318845-56318867 TTATATATAATTAAGGGAGAAGG - Intergenic
1068777767 10:60886615-60886637 TTGAGTATTAATAAGTAAAATGG - Intronic
1069989797 10:72308235-72308257 TTATATATATATATGTATGAAGG + Intergenic
1070539673 10:77407038-77407060 TTGTAAAACAATAGGTAAGAGGG - Intronic
1071704607 10:87983412-87983434 TAGTATAAAAATAAGTGAGTGGG - Intergenic
1072106384 10:92278260-92278282 TTTTCTATAAAGAAGTCAGATGG + Intronic
1072171544 10:92867671-92867693 TTGTATTTAACTTATTAAGAGGG + Intronic
1074399757 10:113132374-113132396 TTGTAAATAAATTAGAAAGTTGG + Intronic
1075036957 10:119077516-119077538 TTGTATATAAATTAGGACAAAGG - Intronic
1079877908 11:25883581-25883603 TTTTTTATAAATAAATAAAATGG + Intergenic
1081927542 11:46843312-46843334 CTGTATATAAGTAGGTAAAATGG + Intronic
1082858093 11:57827540-57827562 TGGTACATAAATATTTAAGAAGG + Intergenic
1083002274 11:59303636-59303658 TTATTAATAAATGAGTAAGAAGG - Intergenic
1083007986 11:59366978-59367000 TTGTATATTAATAAGCAATTTGG - Intergenic
1085006495 11:73096238-73096260 TTGTATTTAAAAAAGAAAGCAGG + Intronic
1085168012 11:74421589-74421611 ATGAAAATAAATGAGTAAGATGG - Intergenic
1085955452 11:81388233-81388255 ATATATATAAATAAATAAAAGGG + Intergenic
1086233689 11:84600084-84600106 TTGAAAAAAAAAAAGTAAGAAGG + Intronic
1086242499 11:84712261-84712283 TTGAATATAAAAAAATAAGGAGG - Intronic
1086552322 11:88067173-88067195 TTGCATATAAAACATTAAGAAGG + Intergenic
1086737972 11:90330165-90330187 ATGTATATGAATAAATAATAAGG - Intergenic
1086754350 11:90540848-90540870 TTGTTTTTAAATAAATAAGTTGG - Intergenic
1087408004 11:97753122-97753144 TTGAAAATATATAAATAAGAGGG - Intergenic
1087654556 11:100906731-100906753 TTAAATGTAAATAAGGAAGAGGG - Intronic
1087889966 11:103526812-103526834 TTGGATATAAAAAATCAAGAGGG - Intergenic
1088182924 11:107132517-107132539 TGAAATATAAATAAGTAAAATGG - Intergenic
1089315547 11:117588692-117588714 TTGTATCCAAACAAGCAAGAGGG + Intronic
1090452139 11:126816041-126816063 TTGAATACAAATAAATAACAAGG - Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090696419 11:129247969-129247991 TTGTATATAAATAATTCAGGGGG - Intronic
1090800571 11:130169063-130169085 TATTATATAAATAAATAATATGG - Intronic
1092583230 12:9871258-9871280 GTGTATATAAATAAGTAAAATGG + Intergenic
1092991036 12:13899641-13899663 TTGTAATTAAATAAGTCAAAGGG + Intronic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1093517857 12:20012182-20012204 TTGATGATTAATAAGTAAGATGG + Intergenic
1095072737 12:37875664-37875686 TTGGATAAAAATTAGAAAGAAGG - Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1096225183 12:49861590-49861612 TTGTGTAGAAAGAAGTAACATGG + Intergenic
1096424160 12:51487010-51487032 TTGTCTAAAAATAGGTAATATGG + Intronic
1097353764 12:58578110-58578132 AAATATATAAATAAATAAGACGG - Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097561999 12:61219169-61219191 TTTTGAATAAATAAGTGAGAGGG + Intergenic
1098211658 12:68172645-68172667 TTTTATGTAAATAAGAAATATGG + Intergenic
1098238409 12:68441216-68441238 TTGTATGAAAATGAGTAAAAAGG + Intergenic
1098541241 12:71660709-71660731 ATGTATATAAAAAAGTACTATGG - Intronic
1098690281 12:73479283-73479305 TTATATTTACATAACTAAGAAGG + Intergenic
1099001635 12:77185048-77185070 ATATAAATAAATAAGTAAGAGGG - Intergenic
1099360947 12:81700807-81700829 TTGGATATAAATAAATCAGTTGG + Intronic
1099647686 12:85380370-85380392 ATGTATATAAATATATGAGAAGG + Intergenic
1099734322 12:86548867-86548889 TTATTTTTAAATATGTAAGAAGG + Intronic
1100175040 12:92020532-92020554 TTGTAAAAAAATAAATAAAAAGG - Intronic
1100494814 12:95114605-95114627 TAGTCTGTAAATAAGTAATATGG + Intronic
1100510371 12:95265161-95265183 ATGTGTATATATAAGAAAGAGGG - Intronic
1101050959 12:100863592-100863614 TTATTTATAGATAAGTAAAAGGG + Intronic
1101110701 12:101482771-101482793 TTCTATATAAATAATGAAGCAGG - Exonic
1101208096 12:102509011-102509033 TTGTAGATACAATAGTAAGATGG - Intergenic
1101716070 12:107313663-107313685 TTGTACCTAAATAACTAATATGG - Intergenic
1102363628 12:112311822-112311844 TTCTATATTAAGAAGTAAGTTGG + Intronic
1103587538 12:121967318-121967340 TTCCATGTAAATAAATAAGAAGG - Intronic
1104184334 12:126414796-126414818 TTGTAGGTAAATATCTAAGAAGG - Intergenic
1104219634 12:126769516-126769538 TTATATTTAAATAAGTGATAGGG + Intergenic
1104436324 12:128759781-128759803 ATGTATAAAAATAAGGATGATGG - Intergenic
1107477367 13:40751928-40751950 TTTTATTTTAAAAAGTAAGATGG + Intronic
1108410441 13:50141087-50141109 TTATATATTGATAATTAAGATGG - Intronic
1108898388 13:55364815-55364837 TTGTATTTAAATGAGTTAAAGGG + Intergenic
1109386594 13:61636784-61636806 TTATAGATAAAAAAGGAAGAGGG - Intergenic
1109469189 13:62782791-62782813 TATTTTATAAATAAGTAATATGG + Intergenic
1109763470 13:66861757-66861779 ATGTCTATAAATAAATAAAATGG + Intronic
1110956104 13:81554416-81554438 TTTAATATAAATAAGAAATAGGG + Intergenic
1111174960 13:84582225-84582247 TTGTATTTAATTAAGTTAAAGGG - Intergenic
1111477450 13:88770865-88770887 TTGTGTAGAAATAAGTAAAATGG - Intergenic
1111514183 13:89306246-89306268 TTATATTTAAATAAGTACAAGGG + Intergenic
1111659156 13:91187894-91187916 GTGTATAAATATAAGTGAGATGG - Intergenic
1111962083 13:94822907-94822929 TTGTATTTACATAACTAAGAAGG + Intergenic
1113391016 13:109897151-109897173 TTGCAAATAAATCAGAAAGAAGG + Intergenic
1114284153 14:21224077-21224099 TTGTTTATATATATGTATGAAGG - Intronic
1114918267 14:27293755-27293777 GTGTAAATAAATAAATAATAAGG - Intergenic
1115494273 14:33986804-33986826 TTGCATCTAAATTAGTAAGATGG + Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115863356 14:37713878-37713900 TAGTATATCAATAAGTTAGAGGG + Intronic
1116327221 14:43545873-43545895 TAATATATTAATAAGTATGAAGG + Intergenic
1117361345 14:54977669-54977691 TTCTAAATAAATAAATAAAAAGG + Intronic
1118189757 14:63569872-63569894 TTTTATATAAAAAATGAAGATGG + Intergenic
1118583057 14:67324355-67324377 TTTTATTTAAATATGTAAGATGG + Intronic
1120120255 14:80670403-80670425 ATGTATATAAATAGGTAGGTAGG - Intronic
1121299546 14:92859630-92859652 TTATTAATAAATAAGTAAAATGG - Intergenic
1121787338 14:96672149-96672171 TTGGATATAAAGAAGTACAATGG - Intergenic
1121899975 14:97684970-97684992 TAGTATATAGACAAGAAAGATGG + Intergenic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125063473 15:35453276-35453298 GTGTATATATATATGGAAGAAGG - Intronic
1125134624 15:36327525-36327547 ATATAAATAAATAAATAAGAGGG - Intergenic
1126161220 15:45615273-45615295 TAGTAATTAAATAAGTGAGAGGG + Intronic
1126834696 15:52648327-52648349 TGGTATATCAATAAATAAAAAGG - Intronic
1126927954 15:53612113-53612135 TTGGAGATAAATAAGATAGATGG - Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1130643093 15:85697749-85697771 TTGTTTATAAAGGAATAAGATGG + Intronic
1130834637 15:87637524-87637546 GTTTATATCAATGAGTAAGATGG + Intergenic
1131039286 15:89247171-89247193 TGGTATAAAAACAAGTGAGAAGG - Intronic
1135170830 16:20181814-20181836 TTGGAGATAAATAAATAATAAGG + Intergenic
1136462927 16:30423101-30423123 ATATATATAAATAAATAAAAAGG + Intronic
1137229257 16:46547609-46547631 TTGTATATAGATGACTAAAATGG + Intergenic
1138685737 16:58723951-58723973 TCATAAATAAATAAGTAAAATGG - Intronic
1138832551 16:60392782-60392804 TTCTATGTAGATAAGCAAGATGG + Intergenic
1138906161 16:61337215-61337237 TTTGTTATAAATAAGTAATATGG + Intergenic
1139100481 16:63760668-63760690 TTGTATATCAATAAATTAGGCGG + Intergenic
1139950814 16:70668420-70668442 CTTTTTATAAATAATTAAGATGG + Intronic
1140279571 16:73542378-73542400 TTGTATAAAAATAAGGACGTTGG - Intergenic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1144359384 17:14477507-14477529 AAGTAAATAAATAAATAAGAAGG + Intergenic
1146359925 17:32165781-32165803 TCATATATAAATAAGTAAACAGG + Intronic
1149322637 17:55497249-55497271 TAATAAATAAATAAATAAGAAGG - Intergenic
1149505975 17:57194255-57194277 TTGTTTAAAAATCTGTAAGAGGG - Intergenic
1203192586 17_KI270729v1_random:203922-203944 TTGTATAAAAAAATGTAAGAAGG + Intergenic
1203201951 17_KI270730v1_random:3357-3379 TTGTATAAAAAAATGTAAGAAGG + Intergenic
1153894369 18:9545045-9545067 TAATATAAAAATGAGTAAGATGG - Intergenic
1154950710 18:21206794-21206816 TTATATATTAATAAGTAATATGG - Intergenic
1155139009 18:23026280-23026302 TTAACTATAAATAACTAAGAAGG - Exonic
1155370395 18:25093732-25093754 TTGATTATAATTATGTAAGAGGG + Intronic
1155761234 18:29569846-29569868 TTGTATATAAATAAGAGATCTGG + Intergenic
1156115559 18:33783306-33783328 TTTAATATAAATAATTAAAAAGG + Intergenic
1156542088 18:37923933-37923955 TTTTAAATTAATAAGTTAGAAGG - Intergenic
1156648600 18:39197865-39197887 TAGTATATAAATAAATATCATGG + Intergenic
1157242900 18:46027858-46027880 GTTTATGAAAATAAGTAAGAGGG + Intronic
1158066525 18:53416712-53416734 TAGTAAATAAATAAGGAAAAGGG - Intronic
1158301893 18:56061826-56061848 TAGTATGGAAATAAATAAGAGGG - Intergenic
1158311253 18:56161283-56161305 TTCTATAGAAATAGGTAATATGG + Intergenic
1158802909 18:60933804-60933826 TTGTATAAAAATAAGAGTGATGG + Intergenic
1158993100 18:62890241-62890263 TTATTTATAAATAAATAAAATGG - Intronic
1159062092 18:63526282-63526304 TAGTAAATAAATAAATAAAAAGG - Intergenic
1159236097 18:65674242-65674264 ATTTATATAAATAAATAGGATGG - Intergenic
1159475018 18:68910286-68910308 GTCTAAATAAATAAATAAGATGG + Intronic
1159475762 18:68918960-68918982 TTGTATATAAAAGGGAAAGAAGG + Intronic
1162262956 19:9547493-9547515 TTGTGTATAAGTAAACAAGAAGG - Intergenic
1163850347 19:19659487-19659509 TAGTAAATAAATAAATAAAAGGG + Intronic
1164284280 19:23798650-23798672 TTAGATATAAATATGTAAGTAGG - Intronic
1164628037 19:29742361-29742383 ATATAAATAAATAAGTAAAAAGG + Intergenic
1165452512 19:35892350-35892372 TTTTTTAAAAATAAGAAAGATGG - Intronic
1165573560 19:36795614-36795636 CTTTAAATAAATAAGTAAAAAGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
925757064 2:7143511-7143533 TTTTATATAAATATGAAACAAGG - Intergenic
926525649 2:13976669-13976691 ATGTAGATAAATAAGGAAGAAGG + Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
928265031 2:29803953-29803975 TGGTAAATAGATAAGTAAGATGG + Intronic
928807907 2:35183659-35183681 TAGAATATAAACAAGTAAAAGGG + Intergenic
929360244 2:41079695-41079717 TTAATTATAAATAAGTAAAATGG - Intergenic
929566186 2:42986663-42986685 TAGTATATGAATAATTAAGCAGG + Intergenic
930265904 2:49198845-49198867 GAGTATATAATTAAGTAAGTGGG + Intergenic
930567062 2:53034304-53034326 TTGCATAGAAATAGGTAAGTAGG + Intergenic
930635028 2:53795074-53795096 TTGTTTATAAATAAGTCTGTAGG + Intronic
930906725 2:56577546-56577568 CTGTCTATAAATAAATAAGTAGG + Intergenic
931222970 2:60304901-60304923 GTTTAAATAAATAAGTAAGTAGG + Intergenic
931325963 2:61223535-61223557 TAGTATATAAAACAGTAGGATGG + Intronic
931968263 2:67557458-67557480 TTTTAATTCAATAAGTAAGACGG + Intergenic
933103556 2:78291141-78291163 TTGTTTACAAATAAGTAAGTTGG + Intergenic
933222928 2:79711836-79711858 TTGTCCATAAATAAGTTATATGG - Intronic
933353042 2:81179671-81179693 TTGAATACAAACAAGTAAAAAGG + Intergenic
934697887 2:96413339-96413361 CTCTAAATAAATAAATAAGAAGG + Intergenic
937573089 2:123387695-123387717 GTGCATCCAAATAAGTAAGAAGG + Intergenic
939048034 2:137272742-137272764 TTGGTGAAAAATAAGTAAGAGGG + Intronic
939255515 2:139739752-139739774 TTGTATACATATTAGTGAGAGGG + Intergenic
939370106 2:141287945-141287967 TTATATATACATATGTGAGATGG - Intronic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
940076495 2:149748014-149748036 CTGTATATTAATAAGAAAAAAGG + Intergenic
940724316 2:157318424-157318446 TTGTATATAAAATTGTAAAAAGG - Intergenic
941376055 2:164732131-164732153 TTATATATATACAAGTAATAGGG - Intronic
941396043 2:164974162-164974184 TTGTTTATAAAATAATAAGATGG - Intergenic
942027594 2:171925843-171925865 TTTTATATAAAAAGGAAAGACGG + Intronic
943107055 2:183558649-183558671 TTGAATGTACATAAGAAAGAAGG - Intergenic
943343027 2:186704032-186704054 TTAAATATAAATAAGTAAATGGG - Intronic
943833907 2:192494599-192494621 CTGTACATTAATAAGTCAGAGGG + Intergenic
944144476 2:196491649-196491671 TTGTTAATAAATTAGTCAGAAGG - Intronic
944666303 2:201962274-201962296 TTGTATGCATATAAGCAAGAGGG + Intergenic
944889369 2:204101348-204101370 TAAAATATAAATAAATAAGAAGG + Intergenic
945523529 2:210859750-210859772 TTCTTTATAAATAAGATAGAGGG + Intergenic
945763189 2:213940852-213940874 CTGTTTATAAATAAGTTAGGAGG - Intronic
946221541 2:218231937-218231959 TTGTATATAAATAAATAAGTAGG + Intronic
946704060 2:222439924-222439946 TTGGGTATAATTATGTAAGAAGG + Intronic
946859175 2:223983914-223983936 ATATAAATAAATAAATAAGATGG - Intronic
947199338 2:227600506-227600528 TTGTAAATAAATAAGAAAGTTGG + Intergenic
947972402 2:234335161-234335183 TTGAATATAAATAAAGAAGCAGG - Intergenic
948853713 2:240720418-240720440 TTTCATTTAAATAAGAAAGACGG - Intronic
1168780571 20:485926-485948 TTGTAAAAACATAAGTAAAATGG - Intronic
1169461596 20:5800391-5800413 TTGTATTTAAATAATTTATAGGG + Intronic
1170332222 20:15225797-15225819 TTGTATATAATAAGGCAAGATGG - Intronic
1170781898 20:19433192-19433214 TAGTCTATTAATAAGTAACAGGG - Intronic
1170995620 20:21354249-21354271 TTGTATATAAATTAATTAGTAGG + Intronic
1171287685 20:23955405-23955427 TTGTGTATAAATAGGGCAGAAGG - Intergenic
1172318791 20:33979529-33979551 TTTTATATCACTAAGTCAGATGG + Intergenic
1173324727 20:42022377-42022399 TTGCAGAAATATAAGTAAGAGGG + Intergenic
1174287085 20:49481411-49481433 TAGTTTAAACATAAGTAAGAAGG - Intronic
1174945950 20:54985245-54985267 TTGTGTATACACAAATAAGAAGG - Intergenic
1176275750 20:64267381-64267403 TTGCATTTAAAAAAGTAACAGGG + Intronic
1176912938 21:14589516-14589538 TTAAATATACATAATTAAGAAGG + Intergenic
1177165176 21:17593960-17593982 TTCTATAAAAATAAGTTTGATGG + Exonic
1177575863 21:22955066-22955088 TTGTTTATAAATAAATAGTAAGG + Intergenic
1177848475 21:26319034-26319056 TTTTAAATAAATCAGTAATAAGG - Intergenic
1178129809 21:29559498-29559520 TTGGAAATAAAGAAGCAAGAAGG + Intronic
1178556745 21:33597913-33597935 TTGTACATTAAAAAGTAAGGAGG - Intronic
1180890703 22:19286322-19286344 TTGTAAATAAACAAGTCAGAAGG + Intronic
1183446556 22:37860031-37860053 GTGTATATAAATAATACAGATGG - Intronic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
949110278 3:252187-252209 TTATGTTTAAATAAGTAACAAGG - Intronic
949291371 3:2470373-2470395 TTTTATAAAAATAAGCAACATGG - Intronic
949676271 3:6457186-6457208 TTGAATATAATTAAGTAAAAAGG - Intergenic
949910600 3:8903288-8903310 TTGTATATATTTAAGAAAGCGGG - Intronic
950652709 3:14417195-14417217 TTATAAATAAACAAGTAAAATGG + Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951365132 3:21771782-21771804 TTGAAAATAAATAACAAAGATGG + Intronic
951420623 3:22479960-22479982 TAGTAAAAAAAAAAGTAAGAAGG + Intergenic
951799672 3:26581641-26581663 TTGATTAAAAATAAATAAGATGG + Intergenic
951829394 3:26907602-26907624 TTGTATTGAAATACTTAAGATGG - Intergenic
952600183 3:35070581-35070603 ATGTATATATATAAGCCAGAAGG - Intergenic
952916496 3:38249164-38249186 TTTTATATAAATAATGGAGAGGG - Intronic
954308194 3:49742895-49742917 TAGTATATAAATAAATAAATTGG + Intronic
954455292 3:50594862-50594884 TTTTATATCAATAAGTGTGAAGG + Intergenic
955740090 3:62081344-62081366 ATCTAAATAAATAAATAAGAAGG - Intronic
955950943 3:64241457-64241479 ATGTATATATGTAAGTAACATGG + Intronic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956888048 3:73580243-73580265 TTGTATGTATACAAGTGAGAGGG + Intronic
956914956 3:73861224-73861246 TTATACATACATAAGCAAGAGGG + Intergenic
956988116 3:74728231-74728253 TTGTTTTTAAATACTTAAGAAGG + Intergenic
957380927 3:79428307-79428329 ATGTATAAAAATAAATAAAATGG + Intronic
957541109 3:81570108-81570130 CTTTATAAAAATAAGTAAGCAGG - Intronic
957745569 3:84337708-84337730 TTGGATATATATGAGTAAGTAGG + Intergenic
957751609 3:84425945-84425967 TAATTTATTAATAAGTAAGAAGG - Intergenic
957797494 3:85030642-85030664 ATATATAAATATAAGTAAGATGG - Intronic
958430377 3:94033010-94033032 TTGTATATACATACATAAAATGG + Intronic
958950333 3:100409346-100409368 TTGTAAATAAATAAATAGGCTGG + Intronic
958997944 3:100927410-100927432 TTGTAAATAACTCAGCAAGAAGG - Intronic
959314727 3:104788830-104788852 TTGTACAAAAAGAAGAAAGAAGG + Intergenic
960285020 3:115818755-115818777 ATATATATATATAAGAAAGAAGG + Intronic
960412821 3:117348811-117348833 TTGTGTATACAGAAATAAGAGGG + Intergenic
960659844 3:120045490-120045512 TTTTTTTTAAATAAGGAAGAGGG - Intronic
960779187 3:121299255-121299277 TTTTATAGAAATAATTAAGCTGG + Intronic
961707679 3:128801101-128801123 TTGTATTTAAAGAAATAAGGAGG + Intronic
962645809 3:137438862-137438884 TTGGTTACAAATAACTAAGATGG - Intergenic
962855070 3:139337765-139337787 TTTTATATAAATAAATAAATAGG - Intronic
963338112 3:144000773-144000795 TTATCAATAAATAAGTAATAGGG - Intronic
963550654 3:146717766-146717788 TTTTAAATAAATAAATAAGTAGG - Intergenic
963814527 3:149814258-149814280 TACAATATAAATAAGTAAGGTGG + Intronic
964598103 3:158460388-158460410 TAGTAGATAATTAAGTAATAAGG + Intronic
965159360 3:165111972-165111994 ATGTAGAGAAATGAGTAAGAAGG + Intergenic
965799140 3:172473778-172473800 TTATATATAAAAAAGAAAAAGGG + Intergenic
965876171 3:173323519-173323541 TTTTTTAAAAATAAGTAAAAGGG - Intergenic
966089020 3:176108035-176108057 GTGTTTAAAGATAAGTAAGAGGG + Intergenic
966367878 3:179210386-179210408 TTATATATACATAAGAGAGAAGG - Intronic
967047706 3:185752908-185752930 TTTTAAAAAAATAAGTAAGAGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967475952 3:189918951-189918973 TAGTACATAGATAAGTAAAAGGG + Intergenic
967477333 3:189937208-189937230 ATGTATATAAGTAAGTAAATAGG - Intergenic
967563859 3:190950695-190950717 TTTAAAATAAATAAGTAAAAAGG - Intergenic
967647304 3:191941042-191941064 TTGTATAGAAAAAATTAATAGGG + Intergenic
967755491 3:193163809-193163831 TTGTTAATATATAAGTTAGAGGG - Intergenic
970286064 4:14517185-14517207 TGGGATTTAAAAAAGTAAGAAGG + Intergenic
970827903 4:20299116-20299138 TTTTATATATATAAGCAAGCAGG + Intronic
971124646 4:23740093-23740115 CTGTTTATAAAATAGTAAGATGG - Intergenic
971384133 4:26127567-26127589 GAGTATATAAGTATGTAAGATGG + Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971529068 4:27661576-27661598 TTATAGACAAATAAGTAAGCAGG - Intergenic
971951121 4:33347776-33347798 TTGGATATAAATAATTGAAATGG - Intergenic
972036662 4:34531347-34531369 TTTTTTAAAAATAAGTAAGTTGG + Intergenic
973630434 4:52815310-52815332 ATATATATAAATAAGTCACAGGG - Intergenic
974006807 4:56566181-56566203 AAGTAAATAAATAAATAAGAAGG - Intronic
974331886 4:60490255-60490277 TTCTATAAAAATAAATAAAATGG + Intergenic
974405767 4:61466760-61466782 TTGTATATCAATTAATAAAATGG + Intronic
975417393 4:74120751-74120773 TCTTATATACATAAGTGAGATGG + Intronic
976253404 4:83076390-83076412 ATATATATAAAAAAGTAAAATGG + Intergenic
976413463 4:84744549-84744571 TTTTATTAAAAAAAGTAAGAAGG + Intronic
976553288 4:86421548-86421570 TTGTATCTAAAAAAGAAAGTAGG + Intronic
976858695 4:89636116-89636138 TTTTATATAACTATGTAAGTAGG + Intergenic
977789076 4:101076603-101076625 TTGGATAGAAATAAGTATGCAGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
977989637 4:103425268-103425290 TTTTAGATAAATAAGTGGGATGG + Intergenic
978416178 4:108478633-108478655 TTTTTTAGAAATAAGTAAGAAGG - Intergenic
978932467 4:114331677-114331699 TTGATTTTAAATAAGTAAAAAGG - Intergenic
980160140 4:129151015-129151037 AGGAATATAAATAAATAAGAAGG - Intergenic
980436088 4:132776005-132776027 TTGTCTATAAACTAGGAAGATGG - Intergenic
980658169 4:135816886-135816908 TTGAAAATAAATAACTAAGTTGG + Intergenic
981168651 4:141594434-141594456 TTTTATATATATATTTAAGAAGG - Intergenic
982227659 4:153181016-153181038 TTGCATATAGAAAAGTGAGAAGG + Intronic
983078013 4:163349371-163349393 TTGTAAATAAACAAGGTAGATGG + Intronic
983437972 4:167740306-167740328 ATGTATATAAACAAGAAAGAGGG + Intergenic
983586384 4:169359513-169359535 TTATATATTAATATGTAAAATGG - Intergenic
984228800 4:177068279-177068301 TTATAAATAAATAATTAAGATGG - Intergenic
984825295 4:183918957-183918979 TTGCAAATGAATAAGTAACATGG - Intronic
985249644 4:188010689-188010711 TTATATAAAAATAAGTAACACGG - Intergenic
985613438 5:903939-903961 TTGAGTACAAATAAGAAAGAGGG + Intronic
987678058 5:21101074-21101096 TTATATATTTATAAGAAAGAAGG + Intergenic
987753746 5:22073665-22073687 TTGTATACAAATAAATCACAAGG - Intronic
988311196 5:29559707-29559729 TTATATAAAAATAATTAAAATGG + Intergenic
988401363 5:30765034-30765056 TTGTAGATAAATAGATGAGATGG + Intergenic
988451493 5:31348344-31348366 TTATATATAAAAAGGTAATAAGG - Intergenic
988572749 5:32387316-32387338 TTTTAAATAAATCAGCAAGATGG + Intronic
988721690 5:33885527-33885549 TTAAAAATAAATAGGTAAGAAGG + Intronic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
989056706 5:37372801-37372823 TTGTATTTAAAAGAGTAACAAGG + Intergenic
989157692 5:38359794-38359816 ATTTATATTAATAAGTGAGAAGG + Intronic
992010521 5:72521607-72521629 TAGTATATAAGTATGTATGATGG + Intergenic
992122886 5:73612392-73612414 ATATATATAAATAAATAATAGGG + Intergenic
992338934 5:75801899-75801921 TTTTATATAAATAATTTAGGAGG - Intergenic
993756617 5:91738476-91738498 TTATCAAAAAATAAGTAAGAAGG + Intergenic
993773674 5:91963848-91963870 TTTTGTCTCAATAAGTAAGAAGG + Intergenic
993792913 5:92229457-92229479 TTGATTATTTATAAGTAAGATGG + Intergenic
994200786 5:96973472-96973494 TTCTATATAAATATGTCATAGGG + Intronic
994250453 5:97530530-97530552 TTGTATATACATTTGAAAGACGG - Intergenic
994385290 5:99124205-99124227 GTGTACATAATTTAGTAAGAAGG + Intergenic
994648168 5:102495733-102495755 TTATATCTAAATAAATCAGAAGG + Intronic
995326565 5:110895770-110895792 TAGCATATAAAGAAGTTAGAGGG - Intergenic
995530409 5:113086508-113086530 TTCTATATAAAAAAGAAACACGG + Intronic
995739881 5:115344855-115344877 ATTAATATAAATAAATAAGAAGG - Intergenic
995765594 5:115613590-115613612 TAATATATAAATAATTCAGAGGG - Exonic
995789272 5:115866180-115866202 TTATATAAAGATGAGTAAGATGG + Intronic
996296619 5:121925417-121925439 TTGTATATACATAACTAATGAGG - Intergenic
996299030 5:121959849-121959871 TTGCATATAAATACATACGAAGG - Intergenic
996701821 5:126457644-126457666 TTGTATATATATCATTGAGAAGG + Intronic
996966858 5:129316673-129316695 GTGTATTTGAAAAAGTAAGAGGG - Intergenic
996993872 5:129670737-129670759 TTGTATAGAATTAACTCAGAAGG + Intronic
997709245 5:135990179-135990201 TGGTATCTAACTAAGTTAGAGGG + Intergenic
998705263 5:144751889-144751911 TTATCTTTAAAGAAGTAAGAAGG - Intergenic
998710562 5:144820307-144820329 TTGTATTCAAATTAGGAAGATGG - Intergenic
999333041 5:150690804-150690826 TTGTTTTTAAATAATTAAAACGG - Exonic
999910155 5:156188819-156188841 TTGTATATTAATTTGTAAAAGGG - Intronic
1000878156 5:166666273-166666295 TTGTATTTAGATAAGTGAAATGG - Intergenic
1001666419 5:173437059-173437081 GTGTTTAAAAAAAAGTAAGAAGG + Intergenic
1003281513 6:4696359-4696381 TAGTATAAAAAAAAGTAAAAAGG + Intergenic
1003744649 6:8986857-8986879 TTACATATAAATAAGTGATATGG + Intergenic
1003770946 6:9299740-9299762 TTCTATAGAAATAAGTAATAAGG + Intergenic
1003868626 6:10384618-10384640 TTGTTTAAAAAGACGTAAGAAGG + Intergenic
1005502226 6:26438914-26438936 ATTTAAATAAATAAGTATGATGG + Intergenic
1006060971 6:31418715-31418737 TTCTTTCTAAATTAGTAAGAGGG + Intergenic
1006524880 6:34595743-34595765 TTTGATTTAAATAAATAAGAAGG + Intronic
1006672873 6:35740554-35740576 TTGTATATGTGTAAGTTAGAAGG + Intronic
1008266883 6:49438998-49439020 TTATATATATATATGTAAGGGGG - Intronic
1008453262 6:51677849-51677871 TTGAATTTAAAAAAGTAAAAAGG - Intronic
1008666134 6:53718325-53718347 TTGTATAAAAATGGGGAAGATGG + Intergenic
1008866699 6:56220551-56220573 TTCTGTATAACTAAGAAAGATGG + Intronic
1008954130 6:57196441-57196463 TCTTGTATAAAGAAGTAAGATGG - Exonic
1009440934 6:63677284-63677306 GTGTAGATAAAGAAGAAAGATGG + Intronic
1009560068 6:65228662-65228684 TTTTATAGAAATAGGCAAGATGG + Intronic
1010401621 6:75452707-75452729 TAGTATATAAGTAATTCAGAAGG + Intronic
1011007331 6:82661297-82661319 TTGTACATAGAAAAGTCAGATGG - Intergenic
1011009649 6:82689545-82689567 TTTTATTTATATAAGTAAGATGG + Intergenic
1011792506 6:90913992-90914014 TTGAGTATTAATAAGTAAAAGGG - Intergenic
1012686504 6:102257507-102257529 TTCTAAATAAATAATTTAGAAGG + Intergenic
1013066602 6:106689954-106689976 TTTTATTTAAATAAATAAGTGGG - Intergenic
1013327611 6:109063268-109063290 TTGAAGAGAAATAAGTAGGAGGG + Intronic
1013343124 6:109234916-109234938 TTGTACATGAAAAAATAAGATGG + Intergenic
1013771591 6:113633738-113633760 TTTTATTTAAACTAGTAAGAAGG - Intergenic
1013909870 6:115262270-115262292 TTTTATATAAATAAGTATTCTGG + Intergenic
1015276359 6:131386804-131386826 TAATAAATAAATAAATAAGAAGG + Intergenic
1015830571 6:137364172-137364194 TTGTAATTTATTAAGTAAGAGGG + Intergenic
1015962753 6:138667460-138667482 CTGTATATAAAAAATTAAGGAGG + Intronic
1016149265 6:140718575-140718597 TTCCAAATAAATAAGGAAGATGG - Intergenic
1016193272 6:141297567-141297589 TTGTATATACATGAGTACTATGG - Intergenic
1016310395 6:142727568-142727590 TGGGATATAATTAAGTTAGATGG + Intergenic
1016885313 6:148954223-148954245 TTGTATTGAAACAAATAAGAAGG + Intronic
1017406088 6:154120649-154120671 TTGTATGTAAATAACTGAGGAGG + Intronic
1017861190 6:158398607-158398629 TTTTTTAAAAATTAGTAAGAAGG - Intronic
1018104373 6:160468871-160468893 TTGTATATTAATATGTGAGTTGG + Intergenic
1018425940 6:163680560-163680582 TTATAAATAAATAAATAGGAAGG - Intergenic
1018588471 6:165389244-165389266 TTGTAAATATATAAGCAAGATGG - Intronic
1019077842 6:169404501-169404523 TTGTTTATGAATAAATAAAAAGG - Intergenic
1020048976 7:5068943-5068965 TTCTATATAAATTATAAAGACGG + Exonic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020663981 7:11016358-11016380 TTGTATATAAAGAATAAAAAAGG + Intronic
1020969425 7:14916009-14916031 TAGTTTATGGATAAGTAAGATGG + Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021499409 7:21313720-21313742 TTTTAAAAAAATAAGTAAGGGGG + Intergenic
1022843658 7:34189604-34189626 TTATTTATAAATAAGGAACATGG - Intergenic
1023110330 7:36804418-36804440 TTGACTAAAATTAAGTAAGAAGG - Intergenic
1023450801 7:40282869-40282891 ATGTAAATAAATAAATAATATGG + Intronic
1023637189 7:42224264-42224286 ATGTAGAAAAATAAGCAAGATGG - Intronic
1024376598 7:48645938-48645960 TTGTATAGAAAATAGTAACAAGG + Exonic
1024514846 7:50239572-50239594 TTCTATATTCATAAGTAACATGG - Intergenic
1024668818 7:51572133-51572155 GTGTATATATATACGTGAGATGG + Intergenic
1026058167 7:67003286-67003308 TTGTATAAAAAGAAGTCAAAAGG - Intronic
1026719922 7:72821726-72821748 TTGTATAAAAAGAAGTCAAAAGG + Intronic
1027466624 7:78523305-78523327 TGCTATATAAATATATAAGATGG + Intronic
1027769151 7:82384747-82384769 TTGTATATAAATGACAAAAATGG + Intronic
1028303422 7:89230531-89230553 ATGTAAATAAGTAAATAAGACGG + Intronic
1028383767 7:90229179-90229201 GTGTATATAATCAAGTCAGACGG - Intronic
1028484387 7:91342205-91342227 TTTTTTATAAATAAGTAACTGGG - Intergenic
1028693762 7:93684127-93684149 TTGTATAAAAATAAGCCAGGAGG + Intronic
1029102084 7:98139413-98139435 TAGTATAAAAATAAGAAAAATGG - Intronic
1029957804 7:104658256-104658278 TTCTAGATAAATTAGAAAGAAGG + Intronic
1030930204 7:115513354-115513376 TTGTAAATAAAAAAGAGAGAAGG - Intergenic
1030946086 7:115722481-115722503 TTGTAGATAAACAGGAAAGAGGG + Intergenic
1031068228 7:117131947-117131969 TTGGAGATAAATGAGTAAGTGGG + Exonic
1031619312 7:123916832-123916854 TTGTATATAAAAAATAAAGGAGG + Intergenic
1031949493 7:127877594-127877616 TTATAAATAAATAAATAAGAAGG - Intronic
1032327674 7:130946469-130946491 TTGTCTCTAAATAAATAAAAAGG + Intergenic
1032454363 7:132061663-132061685 TTGAATAATAATAAGTAACATGG + Intergenic
1032941658 7:136799862-136799884 ATGTATATAAATAAATGAAAGGG - Intergenic
1033003516 7:137534576-137534598 TTGTATCTATATAATTAATATGG + Intronic
1033915332 7:146317099-146317121 ATGTATATGAATAAATAAAAAGG - Intronic
1033939002 7:146627740-146627762 TTGTACCTAAATAAGGAAGTTGG - Intronic
1034122747 7:148642292-148642314 TGGTATATAAATAAGTATATTGG - Intergenic
1035393248 7:158519380-158519402 TAGTCTATAAATAAGTAAAGAGG + Intronic
1037164864 8:15815154-15815176 TTGTACATAAAAATGTTAGAAGG + Intergenic
1037381967 8:18295211-18295233 TGGTCTATAAATCAGAAAGATGG - Intergenic
1037489959 8:19388841-19388863 GTGTGTAAAAATAAATAAGATGG + Intronic
1038222006 8:25618226-25618248 TTGTTTATAAATGACAAAGAAGG + Intergenic
1038563949 8:28604053-28604075 TTGTTTTTAAGTAAATAAGATGG - Intronic
1038988292 8:32837412-32837434 CTTTATGTAAATAAGTAATAAGG - Intergenic
1039263174 8:35795180-35795202 TTTTTGAAAAATAAGTAAGATGG - Intronic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1041079646 8:54204110-54204132 ATATATATATATGAGTAAGATGG - Intergenic
1041106494 8:54449008-54449030 TACTATATAAATATGTAATATGG - Intergenic
1041647687 8:60270405-60270427 ACGTATATAAATAAATAAGTAGG - Intronic
1041814396 8:61951753-61951775 TTATATATATATAATTAAAATGG - Intergenic
1041840405 8:62263838-62263860 TCATATATAAATACGTAATATGG - Intronic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1044023237 8:87133661-87133683 TTGTATAACAATCAATAAGAAGG - Intronic
1044186507 8:89259140-89259162 TTGTATAAATAGAACTAAGATGG - Intergenic
1044549911 8:93500508-93500530 TTGTAGATTAAAAAGAAAGAAGG + Intergenic
1044584134 8:93853638-93853660 ATGAATAAAAATAAGTAAGTGGG + Intergenic
1044907065 8:97016437-97016459 TTGTATAAATATAAATAAAAGGG - Intronic
1048195934 8:132331713-132331735 TGGGATATAAATAAGTAAACAGG + Intronic
1048220161 8:132533756-132533778 TTGTAATTAAAGAAATAAGATGG - Intergenic
1048659943 8:136587886-136587908 TTATATATTTATAAATAAGAAGG - Intergenic
1048964180 8:139603451-139603473 TTGTAAGTAACTCAGTAAGAGGG - Intronic
1050548464 9:6728903-6728925 TTGTATGAAAAAAAGGAAGAAGG + Intronic
1051396581 9:16628527-16628549 ATGTATCTAAATAAGTGAGGTGG + Intronic
1051450068 9:17186880-17186902 TTGCATATAAAAAATTAAGTAGG - Intronic
1051516326 9:17934179-17934201 TTGTGCATACATAGGTAAGATGG + Intergenic
1051585699 9:18724697-18724719 TATTATATAAATGAGTATGAAGG + Intronic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1052233103 9:26178541-26178563 TTGTATTGGATTAAGTAAGAAGG + Intergenic
1052452134 9:28644663-28644685 TTCTTTTTAAATAAGTAAAAGGG + Intronic
1052712448 9:32073347-32073369 TAGTAAATCAATAATTAAGATGG - Intergenic
1054726598 9:68658546-68658568 TTATATATATATAATTAAAAAGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1056004946 9:82258996-82259018 TTATCTATATATAGGTAAGAAGG - Intergenic
1056120318 9:83481234-83481256 TTATAAACAAATAAGTAAAAGGG + Intronic
1056511048 9:87306073-87306095 TTGTATATAACTCAGCAAAATGG - Intergenic
1057977029 9:99616684-99616706 TAATGTATAAGTAAGTAAGAGGG + Intergenic
1060654816 9:125363915-125363937 TTGTATATCAATAATTAATCAGG + Intronic
1061173676 9:128978253-128978275 TTGTATATAAGTATGTAAGTAGG - Intronic
1185958102 X:4514317-4514339 TTTTATAACAATAATTAAGACGG - Intergenic
1186621789 X:11249054-11249076 TGGTATATATATAAGTATGATGG + Intronic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187280284 X:17853330-17853352 TTGTATTTATAAAAGTCAGAGGG + Intronic
1188135224 X:26486093-26486115 TTATAAATAAATAAGAAATATGG - Intergenic
1188529223 X:31120346-31120368 TTGTAAGTAAGTAAGAAAGAAGG - Exonic
1188807199 X:34606033-34606055 TTTTATCCAAATAAGTAAAAAGG - Intergenic
1188842195 X:35030079-35030101 TTGTATATATCTTAGTAACAAGG - Intergenic
1189132758 X:38517532-38517554 TTTTAAATAAATAAGTAAATGGG + Intronic
1189283558 X:39836224-39836246 GTGTATATAAATAAATACGGGGG - Intergenic
1189599700 X:42610372-42610394 TTCAAATTAAATAAGTAAGAAGG - Intergenic
1189927304 X:45970077-45970099 TGGTATATAAATAACCAATACGG - Intergenic
1192844887 X:74896268-74896290 TGGTATCTAGATAAGGAAGAAGG - Intronic
1192962051 X:76141659-76141681 CTGGATATAAATAAATAAGAAGG + Intergenic
1193237556 X:79127318-79127340 TTGTATATAAATGACTATAAGGG - Intergenic
1193334499 X:80272734-80272756 AAGTAAATAAATAAATAAGAAGG + Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193698076 X:84733888-84733910 TTGGAAATAAAAAAGTAAAATGG - Intergenic
1193797867 X:85898430-85898452 TTGAAGATAACGAAGTAAGAAGG - Intronic
1193866810 X:86742176-86742198 TTGTCTATAAATAAATAAGAAGG + Intronic
1194064360 X:89243131-89243153 ATATATAAAAATAATTAAGAGGG - Intergenic
1194967729 X:100308178-100308200 TGGTATAAAAATAAGTACGTAGG + Intronic
1195954618 X:110316993-110317015 TTGGATAAAAATAAGTAGTAAGG + Intronic
1196275315 X:113760037-113760059 CTCTAAATAAATAAGTAAGTAGG - Intergenic
1196480930 X:116146645-116146667 GTGCAAATAAATATGTAAGAAGG - Intergenic
1196643260 X:118088813-118088835 TTGTATATAAAAACATAAAATGG + Intronic
1196659608 X:118256150-118256172 TTCAATATACATAAGAAAGAAGG + Intergenic
1196776920 X:119346891-119346913 TAGTATATAAAGAAGAAACAGGG + Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197250655 X:124213207-124213229 TTATATATATATGAGAAAGAGGG - Intronic
1197419456 X:126220389-126220411 TTTTAAATAAATCAGTAGGAAGG + Intergenic
1197561646 X:128030332-128030354 TAGTATTCAAATAAGTAAAAAGG + Intergenic
1197636091 X:128916398-128916420 TTGAATAGACATAGGTAAGAGGG + Intergenic
1197985533 X:132262776-132262798 TTGTGTATAAATAATTTAAAAGG - Intergenic
1198132722 X:133714598-133714620 TTATTTATAAATAAATAAAATGG + Intronic
1198638219 X:138724212-138724234 TTGTATAAAAATAGGTAGCATGG + Intronic
1198859353 X:141053031-141053053 TTGAATAAAAATAATTCAGATGG + Intergenic
1198903342 X:141534361-141534383 TTGAATAAAAATAATTCAGATGG - Intergenic
1199388552 X:147251870-147251892 TTGGAGGTAAGTAAGTAAGATGG + Intergenic
1200718534 Y:6577206-6577228 ATATATAAAAATAATTAAGAGGG - Intergenic
1201389486 Y:13481508-13481530 TTTTACATAAATAAATAATAAGG + Intergenic
1202131762 Y:21618620-21618642 TGGCATATTAATAAGAAAGAGGG + Intergenic