ID: 1090684434

View in Genome Browser
Species Human (GRCh38)
Location 11:129100122-129100144
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 4, 1: 49, 2: 58, 3: 76, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901167120 1:7229053-7229075 CAGGTGGAGGGGAGCCCAGAGGG + Intronic
902968412 1:20029162-20029184 CAGCAGATGTGGAAACCAGAAGG + Intronic
903621949 1:24704457-24704479 AAGTGGATGTGCAGACCAGAGGG - Intergenic
904698968 1:32346989-32347011 CATTTGAGGTGGAGCCCACCTGG + Intergenic
906851039 1:49250897-49250919 CAGCTGATGTGGAGCTCACAGGG + Intronic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
909024539 1:70467722-70467744 CAGCTAATATGAAGCCCAGAGGG + Intergenic
909203510 1:72724941-72724963 CAGCTGATGTGGAGCCCAGCGGG + Intergenic
912887220 1:113488234-113488256 CAGCTGATGTGGATCCCAAAGGG + Intronic
912994978 1:114523698-114523720 CATTTCATCTGGAGCCCACAAGG - Intergenic
913079987 1:115374882-115374904 CAGTTGAGGGGGTACCCAGAGGG - Intergenic
913284937 1:117217591-117217613 CATTTGGGGTGGAGCCAAGATGG + Intergenic
913349500 1:117842307-117842329 CAGCTGAAGTGGAGCCTGGAGGG + Intergenic
914199579 1:145472936-145472958 CAGTTGCTATGGAGATCAGATGG + Intergenic
914478694 1:148046069-148046091 CAGTTGCTATGGAGATCAGATGG + Intergenic
915049102 1:153049186-153049208 CAGCTGATGTGGAGCCTAAAGGG + Intergenic
915053447 1:153102799-153102821 CAGCTGATGTGGAGCCTAAAGGG + Intronic
915284195 1:154842454-154842476 CAGGTGATGTGAAGCTCAGGAGG - Intronic
915289584 1:154874241-154874263 CACTTGATGTGGAGCCAGTATGG - Intergenic
915695810 1:157740102-157740124 AGGGTGATGGGGAGCCCAGAGGG + Intergenic
917252685 1:173079133-173079155 CAGACTATGTGGAGCTCAGATGG + Intergenic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
918483159 1:185001526-185001548 CAGTAGAGGAGGAGCCAAGATGG + Intergenic
918826844 1:189336086-189336108 CAGCCTATGTGGAGCCCATATGG + Intergenic
919207551 1:194437127-194437149 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
919568565 1:199219025-199219047 CAGCTGACATAGAGCCCAGAGGG - Intergenic
920787004 1:209051310-209051332 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
921193027 1:212726530-212726552 CATTTGCTGTGGAGACCAGAGGG - Intronic
921404670 1:214765480-214765502 CAGCTGATGTGGGGCCCAGAGGG - Intergenic
921462538 1:215445445-215445467 AAGATGATATGGAGCCTAGAGGG - Intergenic
921800813 1:219399916-219399938 CAGCTGATGTAGAGACCAGCGGG - Intergenic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
923855208 1:237838751-237838773 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
924647839 1:245895726-245895748 CAGGTGATGTACAGCCCACATGG + Intronic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1063880807 10:10529973-10529995 CAGTTGCTCTGATGCCCAGATGG + Intergenic
1063929532 10:11015445-11015467 CACTTGATGTAGATACCAGAGGG - Intronic
1066455135 10:35565831-35565853 CACTTGATCTGGTGCCCAGAAGG - Intronic
1067195320 10:44112880-44112902 CATTAGAGGTGGAGCCAAGATGG - Intergenic
1068463030 10:57351531-57351553 CAGCTCATGTAGAGCCAAGAGGG - Intergenic
1069806071 10:71125807-71125829 CAGCTGATATGGAGCCCAGGGGG - Intergenic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1070439398 10:76428512-76428534 CAGTTAATGTGGGGCCTGGAAGG - Intronic
1071091481 10:81924042-81924064 CAGGTGATTGGGAGCCCAGTAGG + Intronic
1071736143 10:88303226-88303248 CAGCTGATGTGGAGCCCAGATGG + Intronic
1072743795 10:97926160-97926182 CTGTTTCTGTGGAGCCCAGAAGG + Intronic
1076565157 10:131393524-131393546 CAGTTCAAGTGGAGCCCACCTGG - Intergenic
1076774326 10:132686027-132686049 CAGTTGGTGTGGAAGCCTGATGG + Intronic
1077841718 11:5982704-5982726 CAGTCTATGTGGAGCCCAGAGGG - Intergenic
1079668295 11:23135000-23135022 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1080217010 11:29855414-29855436 CAATTGATATGGAGCCAAAAAGG + Intergenic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1080907171 11:36557619-36557641 AAGTTGAGGAGGAGCCAAGATGG - Intronic
1082003012 11:47404101-47404123 CAGTTGGTTTGGAGGCCATAGGG - Intergenic
1082855856 11:57806007-57806029 CAGTTGCTTTGGGGCCAAGAAGG + Exonic
1083359717 11:62097918-62097940 CAGTTGCTGTGAAGCACAGAAGG - Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084864012 11:72041216-72041238 CAGTGGGGGTGGGGCCCAGAGGG + Intronic
1085022259 11:73217286-73217308 CAGCTGATATGGAGCCCAAGAGG + Intergenic
1085815040 11:79728199-79728221 TAGCTGATGTGGAGCCTAGAGGG - Intergenic
1085856530 11:80181852-80181874 CCGCTGATGTGGAGCCCACAGGG - Intergenic
1086462854 11:87022855-87022877 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1086617980 11:88846487-88846509 CTATTGATGTGCAGCACAGATGG + Intronic
1087337558 11:96863697-96863719 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1087597534 11:100272906-100272928 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1087619828 11:100528644-100528666 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1087946835 11:104172295-104172317 CCCTTGGTGTGGAGCCCAGTTGG + Intergenic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089066551 11:115666331-115666353 TTGTTGATCTGGATCCCAGATGG - Intergenic
1090230637 11:125100768-125100790 AAATTGATGTGGTGCCCTGAGGG - Intronic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1091037552 11:132247120-132247142 AAGTTCATGGGGAGCCCAGGAGG - Intronic
1091529499 12:1340399-1340421 CAGCTGAGGTGGAACCCAGAGGG - Intronic
1091628612 12:2141346-2141368 CAGTTGATGTGGTTGCCAGAGGG + Intronic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1093496447 12:19763295-19763317 CAGCCTTTGTGGAGCCCAGAAGG + Intergenic
1095542807 12:43330314-43330336 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096529727 12:52234993-52235015 CACTTGATTTGGAGTCCAAAGGG + Intronic
1098678498 12:73321264-73321286 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1101049818 12:100849864-100849886 CAATTGATCCGGAGCCCACAAGG - Intronic
1101220289 12:102632045-102632067 GTGATCATGTGGAGCCCAGAAGG + Intergenic
1104654509 12:130563914-130563936 CAGGTTATGTAGAGCCCAGCAGG - Intronic
1105245453 13:18645993-18646015 GGGGTTATGTGGAGCCCAGAAGG + Intergenic
1105277937 13:18947113-18947135 CAGTGGGTGTGGAGCAGAGAGGG + Intergenic
1105396857 13:20044191-20044213 CAGCTGATCTGGAGCCCACAGGG - Intronic
1108775552 13:53761285-53761307 CAGTGGGTGGGGAGCCTAGAGGG + Intergenic
1109035951 13:57260476-57260498 CAGTTGCTATGGAGATCAGATGG - Intergenic
1109326206 13:60870378-60870400 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1109667133 13:65553746-65553768 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1111113711 13:83749450-83749472 CAGCTGATGCGGAGCCCAGAGGG + Intergenic
1111171400 13:84530724-84530746 CAGGAGACGTGGAGGCCAGAGGG + Intergenic
1111526415 13:89476665-89476687 CAGCTGATGTGAAGCCCAGAAGG - Intergenic
1113669462 13:112165821-112165843 CAGCTGATGTGAAGCCCAGTGGG + Intergenic
1114059059 14:19002290-19002312 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1114103484 14:19399464-19399486 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1114134645 14:19834223-19834245 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1114425834 14:22621746-22621768 CACTTGGGGTGGAGCCAAGATGG - Intergenic
1115601031 14:34956169-34956191 CACCTGATGTGGAGACCAGAGGG + Intergenic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1116243483 14:42378771-42378793 CAGCTGATGTGTAGCCCAGAAGG + Intergenic
1118478488 14:66141177-66141199 CAGCTGATGTGAAGCCCAGAGGG + Intergenic
1118540042 14:66813625-66813647 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1118854411 14:69610344-69610366 AGGTTGCTGTGGGGCCCAGAAGG + Intergenic
1119436683 14:74601992-74602014 GAGCTGATGTGGACCCAAGAGGG + Intronic
1121714941 14:96067122-96067144 CAGGTGCTGGGGTGCCCAGAAGG + Intronic
1123496752 15:20834341-20834363 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123553986 15:21407933-21407955 CAGCTGATGTGGAGCCTGGAGGG - Intergenic
1123577698 15:21689797-21689819 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1123590231 15:21845298-21845320 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123614322 15:22132278-22132300 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1125184458 15:36914616-36914638 AAGCTGAAGTGGAGCCGAGAGGG + Intronic
1125367403 15:38932669-38932691 CAGCTCATGTGGAACCCAGAGGG - Intergenic
1126225157 15:46261821-46261843 CAGCTGATGTGCAGATCAGAGGG - Intergenic
1126506263 15:49407160-49407182 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1127098214 15:55535050-55535072 CTGCTGAAGAGGAGCCCAGAGGG + Intergenic
1127854231 15:62941548-62941570 CAGGTGCTGTGGGGTCCAGAGGG - Intergenic
1128833675 15:70791949-70791971 CAGTTGAATTGGAGCACAGCTGG + Intergenic
1128842811 15:70863942-70863964 CAGCTGATGAGCAGCACAGAAGG - Intronic
1132244725 15:100285757-100285779 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
1202962334 15_KI270727v1_random:135129-135151 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1202986567 15_KI270727v1_random:424042-424064 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1134651316 16:15911151-15911173 AGGCTGAGGTGGAGCCCAGAAGG + Intergenic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1137527101 16:49245960-49245982 CAGTGGCTGTGTTGCCCAGAGGG + Intergenic
1138433853 16:56986240-56986262 CAGGAGATATGGAGTCCAGAGGG + Intergenic
1140514363 16:75531494-75531516 CAGTTGATGGGGAGCTGGGATGG + Exonic
1142212967 16:88817085-88817107 CAGCTGATGTGGGTCCCAGCAGG - Intronic
1142366505 16:89652699-89652721 CAGTTGCTGTTGGGCACAGAGGG - Intronic
1143268634 17:5659220-5659242 GACTTGATGCTGAGCCCAGAAGG - Intergenic
1143769802 17:9161407-9161429 CAGCTTATTTGGAGCCCTGAAGG + Intronic
1144193066 17:12863921-12863943 CAGTTGATGGCCAGCACAGATGG - Intronic
1148228601 17:45916895-45916917 GAGGTGATGTGGGGCACAGAAGG - Intronic
1151242433 17:72768616-72768638 GAGATAATGTGGGGCCCAGAGGG - Intronic
1151532183 17:74713637-74713659 CAGATGCTTGGGAGCCCAGAAGG + Intronic
1153399345 18:4666533-4666555 CAGCTGGTGTGAAGCCCAAAGGG + Intergenic
1154454659 18:14510025-14510047 CAGCTGATGTGGAGCCTGGAGGG - Intronic
1155113181 18:22736926-22736948 CAGTCTATGTGGCACCCAGAGGG + Intergenic
1155823553 18:30409117-30409139 CCGTTGCTATGTAGCCCAGATGG - Intergenic
1156076193 18:33282286-33282308 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1159272051 18:66165478-66165500 TAGTGGATATGGAGGCCAGAAGG + Intergenic
1159547293 18:69855390-69855412 CAGTTGACTTGGAACCCCGAAGG + Exonic
1166299449 19:41905819-41905841 CAGCTGATGGTGAGACCAGAGGG + Exonic
1168637464 19:58007794-58007816 TAGGTGATGTAGTGCCCAGATGG + Exonic
1202636317 1_KI270706v1_random:47535-47557 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
925553854 2:5106752-5106774 CAGATGATGTGCAACCCAAAGGG - Intergenic
927968972 2:27292077-27292099 CATTTATTCTGGAGCCCAGAAGG - Intronic
928490425 2:31777884-31777906 CAGATAAAGTGGAACCCAGAGGG + Intergenic
929381942 2:41364461-41364483 TAGCTGATATGAAGCCCAGAGGG + Intergenic
930403267 2:50919233-50919255 GAGTTGTTATGGAGCACAGAAGG + Intronic
930513903 2:52381084-52381106 CAAGGAATGTGGAGCCCAGAAGG - Intergenic
930930300 2:56874579-56874601 CAGCTGTTGTGGAGCCCAGAGGG + Intergenic
931489270 2:62726176-62726198 CAGCTGATGTGGAGCTCAGAGGG - Intronic
932539613 2:72638734-72638756 CAGCTCATGTGGAGCCTAGAGGG + Intronic
932632940 2:73362341-73362363 CAGATGATGTGAAGGCCATAAGG + Intergenic
933555335 2:83823929-83823951 CAGCTGATGTGAAGCCTAGATGG - Intergenic
934099614 2:88640733-88640755 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
934161634 2:89255120-89255142 CAGTTGATGTGCAGTAGAGAGGG + Intergenic
934196622 2:89842311-89842333 CAGTTGATGTGGACCCACAAAGG + Intergenic
934205650 2:89927295-89927317 CAGTTGATGTGCAGTAGAGAGGG - Intergenic
934816740 2:97333972-97333994 CAGTTGATGTGGACCCACAAAGG - Intergenic
934820956 2:97374512-97374534 CAGTTGATGTGGACCCACAAAGG + Intergenic
935414506 2:102801564-102801586 CCGTTGCTATGGTGCCCAGATGG + Intronic
935449171 2:103189761-103189783 CAGCTGATGTGGAGCCCAAAAGG + Intergenic
935711384 2:105902136-105902158 CAACTGATGCAGAGCCCAGAGGG - Intergenic
935847944 2:107187310-107187332 CAGCTGATTAGGAGCCCAGAGGG + Intergenic
935888301 2:107648502-107648524 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
936589107 2:113786004-113786026 CATTTCATGTAGAGCCCAGCTGG + Intergenic
937195857 2:120156030-120156052 CAGCTGATGTGGAGCCCAGAGGG + Intronic
937569105 2:123334358-123334380 TAGTTGATGTGGAGCCCAGAGGG + Intergenic
938477530 2:131629549-131629571 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
939199768 2:139018779-139018801 CAGCTGATGTGAAGCCCAGAGGG - Intergenic
940436815 2:153665870-153665892 CAGGCAGTGTGGAGCCCAGAGGG + Intergenic
942569866 2:177302979-177303001 CAGTTCCTGAGGAGCCCAGTGGG - Intronic
943092438 2:183390568-183390590 CAGCTGATATGGAGCCCAGATGG - Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
948765304 2:240216388-240216410 CAGTTGCAGTGCAGCCCAGCAGG - Intergenic
1171053515 20:21883568-21883590 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1173425707 20:42941636-42941658 TGGTTGATCTGGGGCCCAGAAGG - Intronic
1174126656 20:48311585-48311607 CAGCCGATGGGGAGGCCAGAAGG + Intergenic
1176819507 21:13643283-13643305 CAGCTGATGTGGAGCCCGGAGGG + Intergenic
1177356906 21:20019995-20020017 CAGCTGATATGGAGCCTTGAGGG - Intergenic
1180364549 22:11926781-11926803 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180477543 22:15724906-15724928 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1181727640 22:24822575-24822597 GAGCTGATGTGGAGCAGAGAGGG + Intronic
1182825635 22:33262513-33262535 CAGTTCATGAGGAGGCAAGATGG - Intronic
1184244660 22:43229897-43229919 CAGTTGATGGGGACCCCTGAAGG + Intronic
949425297 3:3909459-3909481 CACTTGAGGAGGAGCCAAGATGG - Intronic
950327022 3:12120475-12120497 CAGTTTTTGTGGTGCCAAGAAGG + Intronic
950401888 3:12775366-12775388 CAGAAGAAGTGGGGCCCAGAAGG + Intergenic
950923158 3:16715685-16715707 CAGCTGATGTGGAGCACAGGTGG - Intergenic
951042765 3:18005801-18005823 TGGTTGAGGTGGAGCCAAGATGG - Intronic
951258750 3:20482008-20482030 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
951822367 3:26827141-26827163 CAGCTGATGAGCAGCCCAGAGGG + Intergenic
953544594 3:43855142-43855164 TAATTGATGGGGAGCCCAGCAGG + Intergenic
954522706 3:51243232-51243254 CAGATGATGTGGAGCCCAGGGGG - Intronic
955663242 3:61323856-61323878 CAGTTGATGTTTAGCCCTGATGG - Intergenic
955937200 3:64113181-64113203 CAGCTGATGTGTAGCCCAGAGGG + Intronic
958064792 3:88529175-88529197 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
958768767 3:98402015-98402037 CAGCTGAGGTGAAGCCCAGAGGG + Intergenic
959041062 3:101423937-101423959 CAGCTGATGTGGAGCCCAGAAGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959421520 3:106135363-106135385 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
960887033 3:122406219-122406241 CAGGGGATGTGGAGCCCTTATGG - Intronic
961261828 3:125607875-125607897 CAGTTTATGAGGAGCCAAAATGG - Intergenic
961647008 3:128398030-128398052 AGGGTGATGAGGAGCCCAGAAGG + Intronic
961987972 3:131157922-131157944 CAGCTGATGTGAAGTCCAGAGGG + Intronic
962335693 3:134527980-134528002 CAGCTGATATGGAGCCCAGAGGG - Intronic
962655813 3:137542911-137542933 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
962836820 3:139196748-139196770 CAGCCGAGGTGGAGCCAAGACGG - Intronic
963914185 3:150842406-150842428 CAGCTGATGTGGAGACTAGAGGG - Intergenic
963936642 3:151060603-151060625 CACATGATGTGGAGCACAAAGGG + Intergenic
964142556 3:153420243-153420265 CAGTCTGTGTGGAGCCCAGAAGG - Intergenic
965147818 3:164928549-164928571 CAGTCTGTGTGGACCCCAGAGGG - Intergenic
965835340 3:172845328-172845350 CAGTCGATGTGAAGCCGAGTGGG - Intergenic
966320898 3:178699792-178699814 CAGCTGATGTGAAGCCCAGAGGG - Intronic
966714358 3:183000697-183000719 CAGCTGATGTGGAGCCCAAAAGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967523646 3:190466522-190466544 CAGCTGATATGGAGCCCAGAGGG + Intergenic
967888248 3:194347456-194347478 CAGCTGAGCTGGAGCCCAAATGG - Intronic
969221410 4:5761271-5761293 CAGGAGATGTTGAGCCCAGTGGG + Intronic
970101131 4:12524115-12524137 CAGCTGATTTGGACCCCAGAGGG + Intergenic
970703483 4:18771115-18771137 CAGTCTGTGTGGAGCCCAGAAGG + Intergenic
971278824 4:25224134-25224156 CTGTTGCTATGCAGCCCAGATGG + Intronic
971598801 4:28567341-28567363 CAGCCTGTGTGGAGCCCAGATGG + Intergenic
972830636 4:42810129-42810151 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
972835289 4:42862937-42862959 CAGATGCTGTGGAGCCCAGCAGG + Intergenic
973366116 4:49210906-49210928 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
973394481 4:49581530-49581552 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG + Intergenic
975022182 4:69503025-69503047 CAGCTGATGTGAAGCCAAGAGGG + Intronic
975361672 4:73477605-73477627 CAGCTGATGTGTAGGCCAAAGGG - Intergenic
975403670 4:73965545-73965567 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
978060228 4:104327613-104327635 CAGTATAGGTGGAGCCAAGATGG - Intergenic
978231787 4:106408576-106408598 CATTTGGGGTGGAGCCAAGATGG - Intergenic
978856364 4:113398779-113398801 AAGTTTTTGTGGAGCCCTGAAGG - Intergenic
979010080 4:115355778-115355800 CAGCTGATGTGCAGCCCAGGAGG - Intergenic
979158651 4:117429970-117429992 CAGCTGATGTGGATCCCAGAGGG - Intergenic
979455001 4:120917131-120917153 CAGTTGAGGAGGAGGTCAGAGGG - Intronic
980148261 4:129015609-129015631 CAGCTCATGTGGATCCCAGAGGG - Intronic
980257753 4:130403573-130403595 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
981454132 4:144933839-144933861 TAGTTGATGTGGAGCCCAGAGGG - Intergenic
981466231 4:145075798-145075820 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
981849978 4:149218680-149218702 CAGCTGACATGGAGCCCAGAGGG + Intergenic
982629875 4:157819184-157819206 CAACAGATGTCGAGCCCAGAGGG + Intergenic
982646260 4:158027723-158027745 CAGATGATATGGAACCCAGAGGG + Intergenic
983420260 4:167507391-167507413 CACCTGATGTGGAGCCCAGAGGG - Intergenic
984113776 4:175652114-175652136 CTGTTGATTTGCAGCACAGAAGG + Intronic
1202763633 4_GL000008v2_random:133402-133424 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
986481263 5:8190479-8190501 CATTTGCTGTGGATCCCAGCAGG + Intergenic
986651209 5:9964880-9964902 CAGGAGATGTGGGGCTCAGACGG - Intergenic
986754707 5:10824329-10824351 CAGATGATGTGGGGCCCAGAGGG - Intergenic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
988336340 5:29913599-29913621 CAGCTGATGTGGGGCCCAGAGGG + Intergenic
988428567 5:31092518-31092540 CAGTTTTTATGAAGCCCAGAAGG - Intergenic
989693348 5:44171015-44171037 CAGCTGATGTGGACTCCAGAGGG + Intergenic
990134715 5:52631370-52631392 CAGCTTGTGTGGAGCTCAGAGGG - Intergenic
990227012 5:53665956-53665978 GAGTTAAGGTGGAGCCAAGATGG - Intronic
990575533 5:57120246-57120268 GAGTTGATGTGGGGCCTAGATGG - Intergenic
991577653 5:68122017-68122039 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
992351506 5:75933684-75933706 CAGTTGGCCTGGAGCCAAGATGG - Intergenic
993228834 5:85204958-85204980 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
993311371 5:86337587-86337609 CAGGTGATGTAGAGCCCACAGGG + Intergenic
994597616 5:101859982-101860004 CAGCTGATGTGAAGTTCAGAGGG + Intergenic
994970410 5:106730382-106730404 CAGCTAGTGTGGAGGCCAGAGGG + Intergenic
995187897 5:109290558-109290580 CAGCTGATGTGGAGCCCAAAGGG + Intergenic
995691329 5:114829544-114829566 CAGCTGATGTGGTGCCCAGAGGG + Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
998743929 5:145235413-145235435 CAGTTGCTGTCAAGCCCAGAGGG + Intergenic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
998876745 5:146607845-146607867 CAGTTGTAATGGAGACCAGATGG - Intronic
998876904 5:146609476-146609498 AACTGGATGTGGAGCCAAGATGG + Intronic
999019931 5:148154162-148154184 CATTTGGTGTAGAGCCCAGAGGG + Intergenic
1007006070 6:38363927-38363949 CAGGAGAAGTGGAGCCCACAAGG - Intronic
1007314939 6:40979594-40979616 CAGGTAGTGTGGAGCCCAGAGGG - Intergenic
1007364122 6:41378547-41378569 CCCTTGATGTGGAGGACAGAAGG + Intergenic
1008332462 6:50260682-50260704 CAGCTGATGTGAAGACCAGAGGG - Intergenic
1009596743 6:65745860-65745882 CAACTGATGTGGAGCCCACAGGG + Intergenic
1010547186 6:77173021-77173043 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1010821392 6:80419578-80419600 CAATTGATATGGATCCCAGAGGG - Intergenic
1011349247 6:86404326-86404348 CAGGTTATATGGAGCCCAGGTGG + Intergenic
1012490818 6:99780632-99780654 CAGCCAATGTAGAGCCCAGAGGG - Intergenic
1012616478 6:101284432-101284454 CAGCTGATGTGGAGCCCAGTGGG + Intergenic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1014183347 6:118408363-118408385 CAGCTAATGTGGAGCCCAGAGGG + Intergenic
1016024435 6:139271824-139271846 CAGTTTCTGTAGGGCCCAGATGG + Intronic
1017963942 6:159247271-159247293 AGGTTGAAGGGGAGCCCAGATGG - Intronic
1018180519 6:161219052-161219074 CAGTTTATCTTGGGCCCAGATGG - Intronic
1018929194 6:168229146-168229168 CAGTTGAAGAGGAGCCCTGAGGG - Intergenic
1020257394 7:6509703-6509725 CAGTTGCTCTGCAGCTCAGAAGG - Intronic
1020588421 7:10103118-10103140 CATTTCCTTTGGAGCCCAGAGGG - Intergenic
1021351233 7:19596150-19596172 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
1021967291 7:25933007-25933029 CAGTCGATGTAGAGCCCAGAGGG + Intergenic
1022406924 7:30098947-30098969 AGGTTGAGGTGGAGCCAAGATGG - Intronic
1023241327 7:38151078-38151100 CAGCTGATACGGAGCCCAGAGGG + Intergenic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1025158953 7:56636373-56636395 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1025727648 7:64081857-64081879 CAGCTCATGTGGTACCCAGAGGG - Intronic
1025756772 7:64351719-64351741 CAGCTCATGTGGTGGCCAGAGGG - Exonic
1027053859 7:75036925-75036947 CAGTTGATGTGCATTCCAGGAGG - Intronic
1027627566 7:80564340-80564362 CAGCTCATGTTGTGCCCAGAGGG - Intronic
1028008821 7:85614589-85614611 CAGCTTATGTGGAGCCCAGAAGG + Intergenic
1028082972 7:86600398-86600420 CAGCTGATGTTGAGCCCAGAGGG + Intergenic
1029494566 7:100890003-100890025 CAGTTTATTGGCAGCCCAGAGGG + Exonic
1032310344 7:130780397-130780419 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1032816475 7:135480370-135480392 CACTTGAAGTGGAGACCAAAGGG - Intronic
1032999904 7:137492640-137492662 CAGCCAGTGTGGAGCCCAGAGGG + Intronic
1034366193 7:150550885-150550907 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1034450504 7:151134769-151134791 CAGTTGATCTGGATGTCAGATGG + Intronic
1035717339 8:1764081-1764103 CAGCTGAGGGGGAACCCAGATGG + Intronic
1037373669 8:18206045-18206067 CAGCCGATGTGGAGCCCAGAGGG - Intronic
1038334914 8:26638261-26638283 CAGGAGAGGTTGAGCCCAGAAGG + Intronic
1039264355 8:35808691-35808713 CAACTAAGGTGGAGCCCAGATGG + Intergenic
1040087898 8:43364897-43364919 CAGCTGATGCGGAGCCCAAAGGG + Intergenic
1040372241 8:46788416-46788438 CAGCTCATGTGGTGCCCAGAGGG - Intergenic
1040380615 8:46868432-46868454 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1040482694 8:47841221-47841243 CAGCCTATGTGGAGCCCAGCAGG + Intronic
1041059960 8:54025751-54025773 CAGTTGCTGTGGAAAACAGATGG - Intergenic
1041404542 8:57483552-57483574 CAAATAATGTGGAGCCCAGAGGG + Intergenic
1042727039 8:71889754-71889776 CAGAAGATGTGGAACCCAAAGGG - Intronic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1043698472 8:83251818-83251840 CAGCTGATATGGAGCCCAGAAGG - Intergenic
1044127283 8:88474192-88474214 CATCTGACGTGGAGCCCAGAGGG + Intergenic
1044142074 8:88668792-88668814 GTGTTCATGTGGAGGCCAGAGGG + Intergenic
1044313699 8:90726175-90726197 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1044567033 8:93675863-93675885 CAGTTGCTGTAGAGACCATATGG - Intergenic
1046895024 8:119463249-119463271 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1048813871 8:138312824-138312846 CAGTTGAAGTGGAGACCATGTGG + Intronic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1050156246 9:2669194-2669216 CAGTTGTTATGGGGACCAGACGG + Intergenic
1050424761 9:5501807-5501829 CAGGTGATGTGGAGCCCAGTAGG + Intergenic
1050944566 9:11500840-11500862 CAGTAGATGAGGAAGCCAGAAGG + Intergenic
1050965428 9:11795584-11795606 CAGTCTGTATGGAGCCCAGAGGG - Intergenic
1051097010 9:13477637-13477659 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
1051116325 9:13698154-13698176 CAGCTGATGTGTAGCCCAGAGGG - Intergenic
1051296480 9:15601265-15601287 AAGTGGCTGTGGAGCCAAGATGG - Intronic
1051359510 9:16269537-16269559 AAGATGATGTGGAACCAAGAAGG - Intronic
1051899659 9:22025094-22025116 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1051937002 9:22455565-22455587 TAGTGGATGTGGAGCCCAAAGGG + Exonic
1052142559 9:25004609-25004631 CTGTAACTGTGGAGCCCAGAGGG - Intergenic
1052489682 9:29149728-29149750 CAGTGTACGTGGAGCCCAAAGGG + Intergenic
1052534116 9:29726352-29726374 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
1056891474 9:90497781-90497803 CAGATGGTGTGGGACCCAGATGG + Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057805328 9:98215854-98215876 CAGCTGGTGGGGAGCTCAGATGG - Intronic
1058453078 9:105114915-105114937 CAAGTGCTGTGGAGCACAGAGGG + Intergenic
1058456094 9:105139497-105139519 CAGTTAGTGAGGAGCCCTGAAGG - Intergenic
1061416640 9:130450813-130450835 CTGGGGAAGTGGAGCCCAGAAGG - Intronic
1062156478 9:135051616-135051638 CAGTTGTAGTAGAGCTCAGAAGG - Intergenic
1203527851 Un_GL000213v1:106287-106309 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1203544387 Un_KI270743v1:118275-118297 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1185648105 X:1629388-1629410 CAGGTGAGATGGAGCCAAGAAGG - Intronic
1186567272 X:10676811-10676833 CAGTCGATGAGGAGTCCAGAGGG - Intronic
1186685724 X:11922729-11922751 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1187801367 X:23067433-23067455 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1188147403 X:26630537-26630559 CAGTTTGCATGGAGCCCAGAGGG - Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188852589 X:35150550-35150572 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
1189678243 X:43486542-43486564 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1189891859 X:45610921-45610943 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1189940733 X:46117899-46117921 CAGTGGCTGTGGAGCACAGAGGG - Intergenic
1191027961 X:55936387-55936409 TAGTCGAGGTGGAGCCAAGATGG + Intergenic
1191137581 X:57082602-57082624 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG + Intergenic
1191609945 X:63101772-63101794 CAGCTAATGTGGACCCTAGAGGG + Intergenic
1191743649 X:64463400-64463422 CAGCAGATATGGATCCCAGAGGG - Intergenic
1191800494 X:65073646-65073668 CAGTTGGCGTAGAGCCCAGAGGG - Intergenic
1191933898 X:66405266-66405288 CAGCTAATGTGGAACCCAGAGGG - Intergenic
1192926475 X:75759619-75759641 CAGCTGATATGGAGCCCAGAGGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193614121 X:83667217-83667239 TAGCTGATGTAGAGCCCAGAAGG - Intergenic
1193635453 X:83944304-83944326 CGGTCCATGTGAAGCCCAGAGGG - Intergenic
1193749756 X:85327073-85327095 CAGTCAGTGCGGAGCCCAGAGGG - Intronic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193799127 X:85914170-85914192 CAGTATACTTGGAGCCCAGAAGG + Intronic
1193823444 X:86194713-86194735 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1193960029 X:87914260-87914282 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1194247983 X:91538315-91538337 CAGATGATATGGAGCCCAGAGGG + Intergenic
1194310623 X:92301452-92301474 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1194512656 X:94814649-94814671 CAGCTAGTTTGGAGCCCAGAGGG - Intergenic
1194549100 X:95274052-95274074 CCGCTGATGTGGAGCCCAGAGGG + Intergenic
1194598466 X:95889452-95889474 TGGTTGAGGTGGAGCCCAGTGGG - Intergenic
1194781403 X:98029034-98029056 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1194827816 X:98584272-98584294 CAATTGACATGGAGTCCAGATGG - Intergenic
1194917579 X:99723711-99723733 CAGCTGATGCAGAGCCGAGAGGG + Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1196468094 X:115993355-115993377 CAGCTGATGAGGAACCCAAATGG + Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1196574510 X:117302469-117302491 CAGTCTGTGTGAAGCCCAGAGGG - Intergenic
1196586869 X:117440081-117440103 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1196899249 X:120367004-120367026 CAACTGATGTTGAGCCCAGTGGG - Intronic
1197076901 X:122363922-122363944 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1197378797 X:125713545-125713567 CAGCTAATGTGGAGCCCAAAGGG + Intergenic
1197887825 X:131236625-131236647 CAGGTGATGAGGAAGCCAGAGGG + Intergenic
1198759063 X:140012097-140012119 CAGCCAGTGTGGAGCCCAGAGGG - Intergenic
1198779681 X:140221475-140221497 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1198891695 X:141403656-141403678 CAGCCTATGCGGAGCCCAGAGGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1199601565 X:149544264-149544286 CAGGAGATCTGGAGCTCAGAAGG + Intronic
1199648812 X:149935220-149935242 CAGGAGATCTGGAGCTCAGAAGG - Intronic
1200566998 Y:4779844-4779866 CAGATGATATGGAGCCCAGAGGG + Intergenic
1200618905 Y:5415738-5415760 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1202256638 Y:22928323-22928345 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202409629 Y:24562076-24562098 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202461154 Y:25108001-25108023 CAGCTTATGTGGTGACCAGAGGG + Intergenic