ID: 1090685477

View in Genome Browser
Species Human (GRCh38)
Location 11:129113107-129113129
Sequence CAAAATGCTACTAGTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 6, 2: 59, 3: 116, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090685477_1090685480 10 Left 1090685477 11:129113107-129113129 CCAGCATCACTAGTAGCATTTTG 0: 1
1: 6
2: 59
3: 116
4: 277
Right 1090685480 11:129113140-129113162 GTGGTGTTATTCAAGGTTTATGG 0: 2
1: 28
2: 94
3: 88
4: 195
1090685477_1090685479 3 Left 1090685477 11:129113107-129113129 CCAGCATCACTAGTAGCATTTTG 0: 1
1: 6
2: 59
3: 116
4: 277
Right 1090685479 11:129113133-129113155 GAGTCTCGTGGTGTTATTCAAGG 0: 1
1: 1
2: 12
3: 88
4: 200
1090685477_1090685478 -9 Left 1090685477 11:129113107-129113129 CCAGCATCACTAGTAGCATTTTG 0: 1
1: 6
2: 59
3: 116
4: 277
Right 1090685478 11:129113121-129113143 AGCATTTTGTATGAGTCTCGTGG 0: 1
1: 0
2: 3
3: 20
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090685477 Original CRISPR CAAAATGCTACTAGTGATGC TGG (reversed) Intronic
902181472 1:14692488-14692510 CGGAGTGCCACTAGTGATGCTGG - Intronic
903094926 1:20962601-20962623 CAGAGTGCCACCAGTGATGCTGG - Intronic
905847972 1:41249452-41249474 CAAAGTGCCACTAGTGATGCTGG - Intergenic
906032016 1:42728857-42728879 CAAAATGCAATGAGTGATCCTGG - Intergenic
906913273 1:49979792-49979814 TGGAATGCCACTAGTGATGCTGG + Intronic
908275367 1:62465328-62465350 TGAAGTGCCACTAGTGATGCTGG + Intronic
908371662 1:63486711-63486733 TAAAGTGCCACTAGTGATGCTGG - Intronic
908571609 1:65417300-65417322 CAAGATGCTAATAGATATGCTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909197075 1:72640850-72640872 CAAAATGAAACTAGTGATGCTGG + Intergenic
909480779 1:76127286-76127308 TAAAATGCTACTAATGATTTGGG - Intronic
910578352 1:88792858-88792880 CAAAGTACCACTAGTGATGCTGG - Intronic
911081603 1:93938265-93938287 CAAAATGTTACTAGTAATTAAGG - Intergenic
911501539 1:98692476-98692498 TGAAGTGCCACTAGTGATGCTGG - Intronic
913136860 1:115899220-115899242 GGAAGTGCCACTAGTGATGCTGG - Intergenic
913423357 1:118698189-118698211 CAAAGTACTACTAGTGATACTGG + Intergenic
913647076 1:120868255-120868277 CAAAGTGCCACAAGTGATGCTGG + Intergenic
914079566 1:144394609-144394631 CAAAGTGCCACAAGTGATGCTGG - Intergenic
914174465 1:145263152-145263174 CAAAGTGCCACAAGTGATGCTGG - Intergenic
914529194 1:148504637-148504659 CAAAGTGCCACAAGTGATGCTGG - Intergenic
914785011 1:150821294-150821316 TGAAGTGCCACTAGTGATGCTGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
917984489 1:180301647-180301669 CAAAATGCCACTAGTGATGCTGG - Intronic
918629016 1:186693436-186693458 CAAAGTGCCATTAGTGATGCTGG + Intergenic
918766282 1:188488378-188488400 CAAAGTGCCACTAGTGATACTGG + Intergenic
918794147 1:188871350-188871372 CAAAATGCCATTAGCAATGCTGG + Intergenic
919331085 1:196172917-196172939 TGAAATGCCACTTGTGATGCTGG + Intergenic
919567669 1:199208875-199208897 CAAATTGCCACTAGTGATGCTGG - Intergenic
919760943 1:201097699-201097721 CCAAATGCTATTACTGATGGGGG - Intronic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
922117119 1:222624591-222624613 CAAAGTGTCACTAGTGATGTTGG + Intronic
922120387 1:222661198-222661220 TAAAATGCCACTAGTGATGCTGG + Intronic
923195737 1:231665365-231665387 CGAAGTGCCACTACTGATGCTGG + Intronic
923647754 1:235841442-235841464 CAACATGGTGCCAGTGATGCTGG - Intronic
923934270 1:238744558-238744580 TGAAGTGCTAATAGTGATGCTGG - Intergenic
923977765 1:239283323-239283345 CAAAGTGTGACTAATGATGCTGG - Intergenic
924366667 1:243301426-243301448 CAAAGTGCCACTAGTGATGCTGG + Intronic
924377533 1:243429040-243429062 CGAAGTGCCACTAGTGATGTTGG + Intronic
1064486750 10:15800617-15800639 TGAAGTGCCACTAGTGATGCCGG + Intronic
1066340865 10:34531775-34531797 TGAAGTGCCACTAGTGATGCTGG - Intronic
1066762211 10:38766139-38766161 AAAAATGCTACTAATGGAGCTGG + Intergenic
1067255680 10:44636771-44636793 CAAAGTGCCACTGGTGATACTGG - Intergenic
1068298289 10:55104774-55104796 CAAAGTGCTACTAGTGATGCCGG - Intronic
1068507440 10:57919963-57919985 CAAAGTGCCATTAGTGATGATGG + Intergenic
1068680323 10:59812368-59812390 AAAAATGTTACTTGTGATCCTGG + Intronic
1068761085 10:60710058-60710080 CAAAGGGCCACTAGTGATGCTGG - Intronic
1069251555 10:66273184-66273206 CAAAGTGCACGTAGTGATGCAGG - Intronic
1070048606 10:72864314-72864336 CGAAGTGCTACCAGTGATGCTGG + Intronic
1070225994 10:74506392-74506414 TGAAATGTCACTAGTGATGCTGG - Intronic
1071007580 10:80900567-80900589 CAAAATGCCAATAGTGCTGAGGG + Intergenic
1071174087 10:82903431-82903453 CAAAGTTCTGCTAGTGATGCTGG + Intronic
1072266944 10:93739741-93739763 CAAAGTTCCACTAGTGATGCTGG - Intergenic
1072472729 10:95728538-95728560 AAAAGTGCCACTAGTGATGCTGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073920972 10:108458497-108458519 CAAAGTGCCACTAGTGTTGTTGG - Intergenic
1074236942 10:111594267-111594289 CTGAATGCAATTAGTGATGCAGG - Intergenic
1074343236 10:112655080-112655102 CCAGATGCTGCTGGTGATGCTGG - Intronic
1074423705 10:113331963-113331985 GAACATGCTACGAGTGCTGCAGG + Intergenic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078309344 11:10223687-10223709 CACAGTGCCACTAGCGATGCTGG - Intronic
1078562169 11:12381906-12381928 CAAAGTGCCACTAGAGATGCTGG - Intronic
1078836509 11:15035338-15035360 CAAACTGCTGCTACTGATTCGGG - Intronic
1079872817 11:25821779-25821801 CAAAATGCCAATAGTGATGCAGG + Intergenic
1080955974 11:37096088-37096110 CAAAGTGCCACTAGTGATCCTGG + Intergenic
1081155961 11:39691173-39691195 AAAGTTGCCACTAGTGATGCTGG + Intergenic
1081949870 11:47035303-47035325 CGAAGTGTCACTAGTGATGCCGG - Intronic
1082177372 11:49076695-49076717 CAAAATGCTAATGATGATGGTGG - Intergenic
1083010521 11:59393531-59393553 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1086688346 11:89759143-89759165 CAAAATGCTAATGATGATGGTGG + Intergenic
1086717514 11:90080802-90080824 CAAAATGCTAATGATGATGGTGG - Intergenic
1087172448 11:95063896-95063918 CGAAGTGCCACTAGTGATGCTGG + Intergenic
1087325585 11:96719374-96719396 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1090685477 11:129113107-129113129 CAAAATGCTACTAGTGATGCTGG - Intronic
1091833194 12:3564911-3564933 CAAAATGCTACCTGTCATGGTGG - Intronic
1092189090 12:6504949-6504971 TGAAGTGCCACTAGTGATGCTGG - Intronic
1092812048 12:12280327-12280349 CAAAGTGCCACTAGTGATGCTGG - Intergenic
1093258139 12:16898338-16898360 CAAAGTCCTACTAATGATGCTGG + Intergenic
1093530143 12:20151030-20151052 CGAAGTGCCACTAGTGATGCTGG - Intergenic
1093791233 12:23252941-23252963 AAAAATGGAACTAGAGATGCGGG + Intergenic
1093805283 12:23424959-23424981 CGAAGTGCCACTAATGATGCTGG + Intergenic
1094479202 12:30867683-30867705 CAATATACTACTAGAGATCCTGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096591308 12:52661223-52661245 CAGAGTGGCACTAGTGATGCTGG - Intergenic
1097332615 12:58348621-58348643 CAAAGTGCCACTAATGATGCTGG + Intergenic
1098215077 12:68207312-68207334 AAAAGTGCCACTGGTGATGCTGG - Intronic
1098266710 12:68728986-68729008 CAAAGTGCCAGTAGTGATACTGG - Intronic
1098501748 12:71200887-71200909 TGTAGTGCTACTAGTGATGCTGG + Intronic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099047670 12:77742963-77742985 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099963462 12:89419130-89419152 AAAGAAGCTGCTAGTGATGCTGG + Intergenic
1100335230 12:93623047-93623069 CCAAATGCTATCAGTGCTGCAGG - Intergenic
1100579109 12:95921889-95921911 CAAAATGATTCTAGTGATTTGGG - Intronic
1101232053 12:102751550-102751572 CAAAATGCTATTACAGCTGCTGG - Intergenic
1101472091 12:105007450-105007472 TAAAGTGCTACTAGTGATGTTGG - Intronic
1102411465 12:112723563-112723585 CAAAATGCCATTAGTGATGTTGG - Intronic
1102781381 12:115568170-115568192 TGAAGTGCCACTAGTGATGCTGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104531650 12:129577057-129577079 CAGAGTGCCACTAGTGATGCTGG - Intronic
1104788078 12:131463555-131463577 AGAAGTGCCACTAGTGATGCTGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105888697 13:24665884-24665906 CAAAGTGTGACTAGTGATGCTGG - Intergenic
1106785033 13:33098656-33098678 CGAAGTACCACTAGTGATGCTGG - Intergenic
1107296088 13:38909263-38909285 CAAAGTGCCACCATTGATGCTGG + Intergenic
1107648836 13:42523739-42523761 CAAAATGCTACCAGTCATAGGGG + Intergenic
1109331076 13:60930744-60930766 CGAAGTGCCACTAGTGATGCTGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109521506 13:63517502-63517524 CAAAGTGCCACTAATGATGCTGG - Intergenic
1110559654 13:76897254-76897276 CAAACTGCCACTAGTGATGCTGG - Intergenic
1110563291 13:76932249-76932271 CAAAATGCCATTAGTGATGCTGG - Intergenic
1110943098 13:81377043-81377065 CAAAGTACTACTAGTGATGCTGG - Intergenic
1111270772 13:85881330-85881352 CAAAATGCCATTAATGATTCTGG - Intergenic
1111495692 13:89046474-89046496 TAAAATGTCACTAGTGATGCTGG - Intergenic
1112542123 13:100324942-100324964 CAAAGTGCTACTAGTAATGCTGG + Intronic
1112707953 13:102093656-102093678 CAAACTGCCACTAGTGATGCTGG + Intronic
1112854881 13:103756282-103756304 CAAACTGCCACTAGTGATGCTGG + Intergenic
1113733595 13:112659624-112659646 CGAAGTGCCACTGGTGATGCTGG - Intronic
1114373693 14:22119149-22119171 CAAAATTCCACTAGTGATGCTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1115283156 14:31687764-31687786 TGAAGTGCCACTAGTGATGCTGG + Intronic
1115830400 14:37332789-37332811 CAAAGTTCCACTAGTGATGTTGG - Intronic
1116451390 14:45070337-45070359 TGAAGTGCCACTAGTGATGCTGG + Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117365530 14:55023544-55023566 TGAAGTGCCACTAGTGATGCTGG - Intronic
1117425265 14:55588417-55588439 CCAAGTGCCACTAGTAATGCTGG - Intronic
1117639448 14:57782818-57782840 TAAAGTGCCACTAGTGATGCTGG + Intronic
1118013908 14:61639417-61639439 CGAAGTGCCACTAGTGATGCTGG + Intronic
1118138919 14:63058284-63058306 CAAAGTGCCACTAGTGGTGCTGG + Intronic
1118405994 14:65424067-65424089 CTAAGTGCCACTAGTGATGCCGG - Intronic
1119627182 14:76188372-76188394 CAAAATACAACTAATAATGCTGG - Intronic
1120581877 14:86261989-86262011 AAAAGTTCTACTAGTGATGCTGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120791201 14:88584788-88584810 TAATGTGCTACTGGTGATGCTGG + Intronic
1121392945 14:93591724-93591746 CGAAGTGCCACTAGTGACGCTGG - Intronic
1122573866 14:102728341-102728363 CAAAATAACACTAGTGATGAGGG + Exonic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1202933545 14_KI270725v1_random:62395-62417 AAAAATGCTACTAATGGAGCTGG + Intergenic
1123426350 15:20173703-20173725 CGAAATGCCACTAGTGATGCTGG - Intergenic
1123535583 15:21180230-21180252 CGAAATGCCACTAGTGATGCTGG - Intergenic
1124574339 15:30894802-30894824 CAATATGTTAATGGTGATGCAGG - Intergenic
1125062892 15:35446015-35446037 CGAACTGCCACTAGTGATGCTGG + Intronic
1125459142 15:39891861-39891883 AAAAATGATACTAGTGCTCCAGG + Intronic
1125814458 15:42572926-42572948 CCAAGTGCCACTAGTGATGCTGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127101847 15:55574064-55574086 TAAAGTGCCACTAGTGATGCTGG - Intronic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1128305513 15:66596227-66596249 TGAAGTGCCACTAGTGATGCTGG + Intronic
1128592160 15:68909093-68909115 CAAAGTGCCCCTAGTGATGCTGG - Intronic
1128624031 15:69180978-69181000 CAAAATGGTAGTAGTGGTGGTGG + Intronic
1129625834 15:77198375-77198397 TGAAATGCCACCAGTGATGCTGG + Intronic
1130350686 15:83089055-83089077 CAAAATCCTGGTAGTGAAGCGGG + Intergenic
1131248503 15:90816340-90816362 CAAAATCCTACCAAAGATGCTGG - Intergenic
1132411667 15:101583326-101583348 CCAAATGTTGCTAGGGATGCAGG - Intergenic
1132773293 16:1577108-1577130 TGACATGCCACTAGTGATGCTGG + Intronic
1134312332 16:13086603-13086625 CAAAATGGTACTAGTGAAAATGG + Intronic
1134426369 16:14150884-14150906 CGAAGTGCCACTAGTGATTCTGG - Intronic
1135239532 16:20791980-20792002 CAAAATGCTATTTGTTTTGCAGG + Exonic
1135854708 16:25997223-25997245 CAAAATAATACCATTGATGCAGG + Intronic
1136035404 16:27535943-27535965 CAAAGTGCCACTAGTGATGCTGG + Intronic
1136488615 16:30589848-30589870 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136857887 16:33675782-33675804 TGAAATGCCACTAGTGATGCTGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1141073747 16:80982887-80982909 CGAAGTGCCACTAGTAATGCTGG + Intronic
1142320031 16:89375866-89375888 CAAAGTGCCACTAGCGATGCTGG + Intronic
1203119464 16_KI270728v1_random:1524261-1524283 TGAAATGCCACTAGTGATGCTGG + Intergenic
1143990369 17:10954509-10954531 CGAAAGGCCACTAGTGTTGCAGG - Intergenic
1145115095 17:20202405-20202427 CAAAGTGCCACTAGTGATGCTGG + Intronic
1146786885 17:35728835-35728857 CAAAGTGCTCCTAATGATGGGGG + Intronic
1148518178 17:48242054-48242076 GAAAATGCTTCTAGTGTTGTTGG - Intronic
1149121672 17:53175296-53175318 CAAAGTACCACTAGTGATTCTGG + Intergenic
1150902380 17:69295309-69295331 GGAATTGCCACTAGTGATGCTGG - Intronic
1153409203 18:4774938-4774960 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1153412999 18:4814759-4814781 AAAAATGGTCCTAGTGAAGCAGG - Intergenic
1153659371 18:7313299-7313321 TAAAGTGCCAGTAGTGATGCTGG - Intergenic
1154156104 18:11945461-11945483 CAAATTGTTACAGGTGATGCAGG - Intergenic
1155758897 18:29539567-29539589 CGAAGTGCCGCTAGTGATGCTGG + Intergenic
1156038773 18:32795286-32795308 CAAAGTGGCACTAGTGATGTCGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1157045934 18:44101792-44101814 CAAAATACCACTAATGATACCGG + Intergenic
1157398924 18:47370027-47370049 TAAAGTGCCACTAGTGATGCTGG - Intergenic
1157794685 18:50562525-50562547 CAAACTGATACCAGTGATGTTGG + Intronic
1158731203 18:60024623-60024645 CAAAGTGCCACCAGTGATTCTGG + Intergenic
1160476114 18:79189834-79189856 AGAAGTGCTTCTAGTGATGCTGG - Intronic
1161925767 19:7298140-7298162 TAAAGTGCCACTAGTGATGCTGG + Intergenic
1163787669 19:19284299-19284321 AAAAGTGCCACTAGTGATGGCGG + Intronic
1164893654 19:31848146-31848168 CTAAGTGCCACTAGTGATGCTGG - Intergenic
1165720599 19:38076639-38076661 CAAAGTGCCACTAGTGATGCTGG + Intronic
1166018173 19:39999537-39999559 CAAAGTGTTAATAGTGATGCTGG - Intronic
1166207831 19:41284133-41284155 CGAAGTTCCACTAGTGATGCTGG + Intronic
1167837803 19:52088847-52088869 TGAAGTGCCACTAGTGATGCTGG + Intronic
926665930 2:15523120-15523142 CGAAGTGTCACTAGTGATGCTGG - Intronic
927167468 2:20338673-20338695 TGAAATGCTACTAGTTATGAGGG + Intronic
927244528 2:20946540-20946562 CAAAGTGCCACTGGTGATGCTGG - Intergenic
927772054 2:25871408-25871430 CAGAATTCTACAAGAGATGCAGG + Intronic
927795367 2:26043466-26043488 CATAATGCTACTATGAATGCTGG - Intronic
928274190 2:29884309-29884331 CAAAGTGACAGTAGTGATGCTGG + Intronic
928850724 2:35741996-35742018 TAAAATGCCATGAGTGATGCTGG - Intergenic
929014792 2:37483374-37483396 CAAAATGCTACTGGTGGTTATGG - Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
930266529 2:49206533-49206555 CAAAGTGCAACTAGTGATGTTGG + Intergenic
930430865 2:51274403-51274425 CAGAATGTTACTCTTGATGCAGG + Intergenic
930717973 2:54610790-54610812 CAAAGTGCCACTAGTGATGCTGG - Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931225890 2:60331466-60331488 CGAAGTGCTGCTAGTGATGCTGG + Intergenic
931529324 2:63196162-63196184 TGAAGTGCCACTAGTGATGCTGG + Intronic
932029547 2:68169283-68169305 TAAAGTGCCACTAGTGATGTTGG - Intronic
933092040 2:78133014-78133036 CGAAGTGCCACTAGTGATGCTGG - Intergenic
935473514 2:103489099-103489121 CAAAGCACTGCTAGTGATGCTGG + Intergenic
936682993 2:114796205-114796227 CAAAGTGCCACTAGTGATGCTGG + Intronic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937088457 2:119188021-119188043 CGAAGTGCCACTAGTGATGCTGG - Intergenic
937162116 2:119774209-119774231 TGAAATGCAGCTAGTGATGCTGG + Intronic
937966434 2:127514989-127515011 GAACATGTTACTTGTGATGCAGG - Intronic
938556950 2:132433528-132433550 CAAAGTGCCACTAGTGGTGCTGG + Intronic
939853222 2:147324889-147324911 CAAAGTGCCACTAGTGATGCTGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940952483 2:159691674-159691696 CCAAGCGCTACTAGTGATGCTGG - Intergenic
941963716 2:171279672-171279694 CAAAGTGCCACTAGTGATGCTGG + Intergenic
942011192 2:171763920-171763942 CAAAATGCCAGTAGTGATTCTGG + Intergenic
942264011 2:174202544-174202566 CCAAGTGCCACTAGTGATGCTGG + Intronic
942265122 2:174216348-174216370 CAAAGTGCTATTAGTGATGCTGG + Intronic
943884923 2:193204418-193204440 CAACATACTACCAGTGATGTGGG - Intergenic
944466616 2:200007626-200007648 CAAAGTGCCACTAGTGATGCTGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946750434 2:222890106-222890128 CAATATGTTAATTGTGATGCAGG + Intronic
947237704 2:227960386-227960408 TAAAGTGCCACTAGTGATGCTGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948841513 2:240652541-240652563 TGAAGTGCCACTAGTGATGCTGG - Intergenic
949038334 2:241831106-241831128 TAAAGTTCTGCTAGTGATGCAGG + Intergenic
1169743825 20:8922809-8922831 CTAGATGCTACTAATAATGCTGG + Intronic
1170259538 20:14388763-14388785 TAAAATGCCACTGGTGATGCCGG - Intronic
1172353759 20:34264497-34264519 CTAGGTGCTACTAGTGATTCTGG + Intronic
1172925455 20:38530038-38530060 GGAAGTGCCACTAGTGATGCTGG - Intronic
1173377308 20:42498033-42498055 CAAAGTACCACTAGTGATGCTGG - Intronic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178153310 21:29821417-29821439 CAGAGTGCCACTGGTGATGCTGG - Intronic
1180585029 22:16880544-16880566 AAAAATGCTACTAATGGAGCTGG + Intergenic
1182139033 22:27936255-27936277 CAAAGTACCACTAGTGATGCTGG + Intergenic
949394381 3:3599231-3599253 CAAAAGGCCACTAGTGATACTGG - Intergenic
949428917 3:3951791-3951813 TGAAATGCCACTAGTGATGCTGG + Intronic
949688408 3:6605339-6605361 CCAAATGCTACTGAGGATGCAGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951011496 3:17686904-17686926 TAAAATGTTAGTAGTGATGAGGG + Intronic
952600863 3:35080647-35080669 TAAAGTGCCACTAGTGATGCTGG - Intergenic
953778920 3:45848396-45848418 CAAAGTGTCACTAATGATGCTGG - Intronic
954884594 3:53861230-53861252 CGAAGTGCCACTAGTAATGCTGG + Intronic
956150760 3:66239995-66240017 TGAAGTGCCACTAGTGATGCTGG - Intronic
957573414 3:81978456-81978478 CAAAGTGACACTAGTGATGCTGG - Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959468107 3:106715280-106715302 CGTCTTGCTACTAGTGATGCTGG - Intergenic
959773473 3:110127406-110127428 TGAAATGCCACTAGTGATGCTGG - Intergenic
959922251 3:111881323-111881345 CGAAGTGCGACTAGTGATGCTGG - Intronic
960009555 3:112818695-112818717 CAAAAGGCAAATAATGATGCTGG - Intronic
960769245 3:121173878-121173900 CAAAGTGCCACTACTGATGCTGG - Intronic
962545233 3:136427504-136427526 ATATGTGCTACTAGTGATGCTGG + Intronic
962783838 3:138747255-138747277 CAAAATGCTACTTGTGATCCTGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963841571 3:150112993-150113015 CAAAGTGCCACTAGTGATACTGG + Intergenic
963922632 3:150920581-150920603 CAAAATGCCACTCATGAGGCTGG + Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964594373 3:158407076-158407098 TAAAATGCTACTGGTTATACAGG - Intronic
964740746 3:159962974-159962996 TAAAGTGCTACTAGTGATGCTGG - Intergenic
964866418 3:161266972-161266994 TGAAATGCCACTAGTAATGCTGG + Intergenic
964956464 3:162364388-162364410 CAAAGTGCCACTAGTGGTGCTGG + Intergenic
965069336 3:163897960-163897982 TGAAGTGCCACTAGTGATGCTGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965357940 3:167700371-167700393 CAAAGTGCCACTAGTGATGTTGG + Intronic
965756251 3:172030481-172030503 CAAAGTGCCACTAGCAATGCTGG + Intergenic
966663461 3:182443564-182443586 CAAAGTGCCACTAGTGATGCTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
968034341 3:195533514-195533536 CAAAATGCCACTAGAGATGCTGG + Intronic
969142752 4:5093866-5093888 CAAAGTGCTAAGAGTGATGCTGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969649512 4:8456381-8456403 CACAATGCCACTGGTGATGCTGG + Intronic
970156462 4:13146687-13146709 CTAAGTGCTACTAGGGATGCTGG + Intergenic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971803754 4:31327510-31327532 CGAAGTGCCACTAGTGATGCTGG + Intergenic
971974749 4:33669677-33669699 CGATGTGCCACTAGTGATGCTGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974538449 4:63200211-63200233 CAAAGTGCCACTGGTGATGCTGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
976426685 4:84912162-84912184 CGAAGTGCCACTAGTGATGCTGG + Intronic
977119000 4:93073158-93073180 AAAAGTGCGACTAGTGATGCTGG + Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978420225 4:108524765-108524787 CAAAGTGCCACTAGTGATGCTGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979863772 4:125727078-125727100 TAAAGTGCCATTAGTGATGCAGG - Intergenic
980388369 4:132114990-132115012 CAAAGTGCCACTAGTGATGCTGG + Intergenic
980482588 4:133406129-133406151 CGAAGTACCACTAGTGATGCTGG - Intergenic
980849331 4:138361484-138361506 CAAAGTGCCTCTAGTGATGCTGG + Intergenic
981056153 4:140363885-140363907 CAAAGTGCCACTAGTGATGCTGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981562426 4:146062564-146062586 CAAAAGCTTACTAGTGCTGCAGG + Intergenic
981571547 4:146156873-146156895 CAAAGTACCACCAGTGATGCTGG + Intergenic
981757772 4:148160139-148160161 CAAAATGTTACTAGTAATTAAGG - Intronic
982747787 4:159122808-159122830 CAAAGTGCCACTGGTGATGCTGG + Intronic
983010652 4:162541430-162541452 AAAAATAGTACTAGTGATTCAGG - Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983715196 4:170773936-170773958 CCAAATGCCATTAGTGATGCTGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983793468 4:171828396-171828418 CAAATTACCACTAGTGATGCTGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984420005 4:179508736-179508758 CAAAGTGTCACTAGTGATACTGG - Intergenic
984444606 4:179819367-179819389 CAAAATGCCACTATTAATGCTGG - Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984535099 4:180964505-180964527 CAAAATGCCACTCGTGATGCTGG - Intergenic
984729284 4:183052477-183052499 CGAAGTGCCACTAGTAATGCTGG + Intergenic
984742665 4:183181342-183181364 CAAAGTGCCACTTGTGATGCTGG + Intronic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987964037 5:24849229-24849251 CAAAGTGCCATTATTGATGCTGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988695690 5:33620289-33620311 CAAAGTGCCACTAGTGATGCTGG - Intronic
988822451 5:34900703-34900725 TGAAGTGCCACTAGTGATGCTGG - Intergenic
989462562 5:41717451-41717473 CAAAGTGCCACTAGTAGTGCTGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991231592 5:64339366-64339388 AAAAATACTACAAGTGATGAAGG - Intronic
992714826 5:79499955-79499977 TGAAGTGCCACTAGTGATGCTGG + Intronic
993929496 5:93920997-93921019 TGAAGTGCCACTAGTGATGCTGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994501539 5:100584929-100584951 CAAAATGCCACTATTGATGATGG - Intronic
994569741 5:101501388-101501410 TACACTGCGACTAGTGATGCTGG + Intergenic
994601110 5:101906595-101906617 CGAAGTACCACTAGTGATGCTGG + Intergenic
995160672 5:108976912-108976934 TAAAGTGCCACTAGTGATGCTGG - Intronic
995788935 5:115862809-115862831 TGAAGTGCTACTAGTGATGTTGG + Intronic
996079580 5:119241678-119241700 CAACATGCCACTAGTAATGCTGG - Intronic
996353143 5:122567874-122567896 TAACAAGCTACCAGTGATGCTGG - Intergenic
997106503 5:131025927-131025949 CAAAGTGCTACTAGTGATGCTGG + Intergenic
997806766 5:136925666-136925688 CAAAATGTGACTTGTGCTGCAGG + Intergenic
997913505 5:137900402-137900424 CAAAGTGCCACTAGTGATACTGG + Intronic
998024309 5:138800945-138800967 CAAAGTGCCACTAGTGATGCTGG - Intronic
999412444 5:151363740-151363762 CAAAGTGCCACTAGTGATGCTGG - Intergenic
1000033528 5:157424067-157424089 CAAAATGCCACTAGTGATGCTGG + Intronic
1000512570 5:162201749-162201771 CAAAATGCCACTAGTGATGATGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000752279 5:165111912-165111934 CAAAGTGCCACTAGTAATGCTGG + Intergenic
1001865560 5:175101498-175101520 CAAAATGCCACTAGTGAAGCTGG - Intergenic
1002219484 5:177668666-177668688 CAAAGTGCTACTAGTGATGCTGG + Intergenic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1004840515 6:19578844-19578866 CAAAGTGCCATGAGTGATGCTGG + Intergenic
1006549575 6:34810200-34810222 CAATGTGCCACTAATGATGCTGG - Intronic
1007732626 6:43957733-43957755 CGAAGTGCCACTAGTGATGCTGG + Intergenic
1008810834 6:55496662-55496684 GGAAGTGCAACTAGTGATGCTGG + Intronic
1009463295 6:63940157-63940179 TGAAGTGCCACTAGTGATGCTGG + Intronic
1009795971 6:68468312-68468334 CAAAGTGCGACTAGTGATGCTGG + Intergenic
1010042513 6:71402359-71402381 CAAAACTCTATTAGTCATGCTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1012000025 6:93642785-93642807 CAAAGTGCCAGTAGTAATGCAGG - Intergenic
1012032638 6:94092064-94092086 TGAAGTGCCACTAGTGATGCTGG + Intergenic
1012106144 6:95161034-95161056 CAAAATGGCACTGGTGACGCTGG - Intergenic
1012684225 6:102224155-102224177 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013436417 6:110114258-110114280 CAAAGTGCCACCAGTGATGCTGG + Intronic
1013857883 6:114596444-114596466 CAAAATGCAAATAGTGGTGCAGG + Intergenic
1014834700 6:126147738-126147760 TAAAATTCTACAAGTGAAGCAGG + Intergenic
1015415063 6:132939024-132939046 AATCATGCTACTAGAGATGCAGG - Intergenic
1017454479 6:154588421-154588443 AAAAATGCTCTTAGTAATGCAGG - Intergenic
1017854132 6:158334184-158334206 TGAAATGGCACTAGTGATGCTGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019228517 6:170536415-170536437 CAAAGCACTATTAGTGATGCTGG + Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1022146042 7:27541693-27541715 CAAAGTGCCACTAGTGATGCTGG - Intronic
1022761032 7:33351619-33351641 CCAAAGGCTAGTATTGATGCAGG + Intronic
1023193198 7:37605744-37605766 CTAAGTACCACTAGTGATGCTGG + Intergenic
1023270046 7:38452769-38452791 GAAAATGCTGCTAATGCTGCTGG - Intronic
1023386546 7:39663470-39663492 AGAAATGTTACTAGTGATGCTGG + Intronic
1024556440 7:50606949-50606971 TGAAATGCCACTAGTGAAGCTGG - Intronic
1027571769 7:79877010-79877032 CAAAGTGCCACTAGTGATGCTGG - Intergenic
1027867749 7:83669395-83669417 CAAAGTGTCACTAGTGATGCTGG - Intergenic
1028305682 7:89260887-89260909 TGAAGTGCCACTAGTGATGCTGG - Intronic
1028394356 7:90350897-90350919 CAAAGTGCCACTAGTGATGCTGG - Intronic
1028628881 7:92911121-92911143 CAAAGTGCCACTGGTGATGCTGG + Intergenic
1030002873 7:105084284-105084306 CAAAGTGCCACTAGTGATGCTGG - Intronic
1030448760 7:109682015-109682037 CAAAATGCATCCAGTGATTCTGG - Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031365285 7:120893610-120893632 TTAAGTGCTGCTAGTGATGCTGG - Intergenic
1031889376 7:127276309-127276331 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1033084400 7:138329104-138329126 CAAAGTGCCACTAGTGATGCTGG + Intergenic
1037148579 8:15606078-15606100 CAAAATGCCACTAGGGATGCTGG + Intronic
1037242966 8:16798405-16798427 CGAAGTGCCAATAGTGATGCTGG + Intergenic
1037439486 8:18900539-18900561 CAAAGTACCACTAGTGATGCTGG - Intronic
1040632156 8:49227165-49227187 CAAAGTGTCACTAGTGATACTGG - Intergenic
1040855732 8:51946575-51946597 CAAAAGCCTCCTAGTGAAGCTGG + Intergenic
1041359515 8:57037577-57037599 CAAAGTGCCACCAGTGATGCTGG + Intergenic
1041857549 8:62475674-62475696 CAAGATCCTACAAGTGATTCTGG + Intronic
1042913852 8:73855118-73855140 CAAAATGCCACCAGTGATGCTGG - Intronic
1043319610 8:78967532-78967554 GGAAGTGCCACTAGTGATGCTGG + Intergenic
1043380474 8:79696885-79696907 GAAAGAGCTACTAGTGATGAGGG + Intergenic
1043539886 8:81249446-81249468 CAAAGTGCCACTAGTGGTGCTGG + Intergenic
1043747099 8:83888253-83888275 CAAAACGCTACCAGTCATGCTGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044653761 8:94525691-94525713 AAAAAATCTACTAGGGATGCTGG + Intronic
1044912658 8:97077209-97077231 CAATGTGCAACTAGTGATGTTGG - Intronic
1045218871 8:100177120-100177142 TAAAGTGTCACTAGTGATGCTGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045981634 8:108196357-108196379 AAAAATGCCACTAGTGGTCCTGG + Intergenic
1046125892 8:109907779-109907801 CTAAATGCAACTAGTGATGCTGG + Intergenic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046446464 8:114326841-114326863 CAAAGTGCCACTAGTGATGCTGG - Intergenic
1047090552 8:121570211-121570233 CAAAGTGCCACTAGTGACGCTGG - Intergenic
1047206127 8:122804045-122804067 CAAACTTCTACCAGTGATGATGG - Intronic
1047321937 8:123794750-123794772 CAGAGAGCCACTAGTGATGCTGG + Intronic
1047598281 8:126400681-126400703 CAAAGTGCCAGTAGCGATGCCGG + Intergenic
1049727343 8:144154401-144154423 CAAAGTGCCAGTAGTGGTGCTGG - Intronic
1050111019 9:2216008-2216030 CAAAGTGCTACTACTGATGCTGG - Intergenic
1050123603 9:2333358-2333380 TAAAATACTACTATTGATACTGG + Intergenic
1050302638 9:4274911-4274933 CAAAATGCAACTTGTGGTGTAGG - Intronic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1053189712 9:36052806-36052828 CAAAATGCAATTTGTGATCCTGG + Intronic
1053373350 9:37581678-37581700 CAGAGTGCCACTAGTGATGCTGG - Intronic
1054743948 9:68835489-68835511 CAAATTGCTACTATTGATGCTGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055396916 9:75885717-75885739 TGAAGTGCTAATAGTGATGCTGG - Intergenic
1055519262 9:77063993-77064015 CATAGTGCCACTAGTGATGTTGG + Intergenic
1055696664 9:78892261-78892283 CAAAAACCTACTAGTGATCCTGG - Intergenic
1057982676 9:99677577-99677599 CTAAGAGCCACTAGTGATGCTGG - Intergenic
1058228918 9:102401415-102401437 CAATGTGCCAGTAGTGATGCTGG - Intergenic
1059109015 9:111537054-111537076 CAAAGTGCTGCTAGTAATGCTGG - Intronic
1059462322 9:114440912-114440934 TGAAGTGCCACTAGTGATGCTGG + Intronic
1059462426 9:114442183-114442205 CAAAATGCAACACGTGATCCTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1187062092 X:15796227-15796249 CAAAGTGCGACTAGCGATGCTGG - Intronic
1187787121 X:22904286-22904308 CAAAATGATGCTAATGCTGCTGG + Intergenic
1188712876 X:33423242-33423264 TGAAGTGCTACTAGTGATGCTGG - Intergenic
1190606882 X:52152432-52152454 CGAAGTGCTACTAGTGATTCTGG - Intergenic
1190772018 X:53522959-53522981 AAAAGTGCCAATAGTGATGCTGG + Intergenic
1191004625 X:55698177-55698199 CAAAGTGCCAATAGCGATGCTGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1195179279 X:102340780-102340802 CAAAATGCTACTTTCCATGCTGG + Intergenic
1196377040 X:115044815-115044837 CAAGATGATACAAATGATGCAGG + Intergenic
1196408368 X:115390090-115390112 CAAAAAGCCCCTAGTGGTGCTGG - Intergenic
1198456259 X:136820729-136820751 TGAAGTGCCACTAGTGATGCTGG - Intergenic
1199275519 X:145937737-145937759 CAAAGTGCCACTAGTGATGCTGG - Intergenic
1199338983 X:146653534-146653556 AAAAATGCTACTAGTGACCTTGG - Intergenic
1199614260 X:149643534-149643556 CAATGTGCCACTAGTGATGCTGG - Intergenic
1200301689 X:154982820-154982842 TAAAGTGCCACTAGTGATGCTGG + Intronic
1200360045 X:155595444-155595466 CAAAGTGCCACTTGTGATGTTGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic