ID: 1090687603

View in Genome Browser
Species Human (GRCh38)
Location 11:129140859-129140881
Sequence CACTCTTTCCCCCTAAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090687600_1090687603 0 Left 1090687600 11:129140836-129140858 CCATTCTGCAGTTCTCAAGACAA 0: 1
1: 0
2: 1
3: 22
4: 281
Right 1090687603 11:129140859-129140881 CACTCTTTCCCCCTAAAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1090687598_1090687603 7 Left 1090687598 11:129140829-129140851 CCACATCCCATTCTGCAGTTCTC 0: 1
1: 0
2: 1
3: 33
4: 347
Right 1090687603 11:129140859-129140881 CACTCTTTCCCCCTAAAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1090687599_1090687603 1 Left 1090687599 11:129140835-129140857 CCCATTCTGCAGTTCTCAAGACA 0: 1
1: 0
2: 5
3: 31
4: 389
Right 1090687603 11:129140859-129140881 CACTCTTTCCCCCTAAAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090687603 Original CRISPR CACTCTTTCCCCCTAAAGGG AGG Intronic
903550072 1:24151807-24151829 CCCTCTTTCCGCCGAAAGGCAGG - Intergenic
908620318 1:65972257-65972279 CACTCAGTCCCCCAAAAGGCCGG + Intronic
915726473 1:158021691-158021713 CAGTCTTTCCCAGGAAAGGGAGG - Intronic
916322771 1:163523157-163523179 CTTTCTTTCCCCCTGAAGGCAGG - Intergenic
917638257 1:176957824-176957846 CACTCTTTCTCCCCACAGAGAGG - Exonic
919730552 1:200911435-200911457 CTCTCTTTCCCTCTTCAGGGTGG + Exonic
922928837 1:229373223-229373245 CACTCTTCCTCCCAAGAGGGAGG - Intergenic
923200245 1:231704265-231704287 CACTCTTGCCACCTGAAGGTGGG + Intronic
923518097 1:234714174-234714196 GACTCATTCCCTGTAAAGGGAGG - Intergenic
924000237 1:239542988-239543010 CACTCTTTGCCCTTAAATGGGGG + Intronic
1065088030 10:22199964-22199986 CATCCTGTCCCACTAAAGGGTGG - Intergenic
1068054452 10:51994132-51994154 CACCCTTTCTTCCTAAAGAGAGG + Intronic
1074400546 10:113138193-113138215 CATTTTTTCCCCCTAAAGCCAGG + Intronic
1077488409 11:2849605-2849627 CACTCTTTCCACCTTAGGAGAGG - Intergenic
1079464809 11:20719674-20719696 CACTCTTTACCCATAGAGGTTGG + Intronic
1083324373 11:61865993-61866015 CACTCTCTGCCCCTAAAGATGGG + Exonic
1083621627 11:64052114-64052136 CACTCTTTCTCACTACAGGGAGG - Intronic
1085206577 11:74737018-74737040 CACTGTGTCCACCTAAAGGTGGG + Intergenic
1087874421 11:103339159-103339181 CACTCTTTCCCCCAAGTGGAAGG + Intronic
1089391864 11:118107681-118107703 CACTCTTTCTCCTGAAAGTGGGG + Intronic
1089926765 11:122266975-122266997 CATTCATTCTCCCTAAAGGTAGG - Intergenic
1090687603 11:129140859-129140881 CACTCTTTCCCCCTAAAGGGAGG + Intronic
1095640069 12:44477260-44477282 CACTCTTTCTCCATTAAGGAGGG + Intergenic
1097974633 12:65671519-65671541 CACTGTTTCCAAATAAAGGGAGG - Intergenic
1103039796 12:117685592-117685614 CACTCTTTGGCCCCAGAGGGAGG - Intronic
1106500928 13:30328042-30328064 GACTCTTTCCCCCTTAAGGCAGG + Intergenic
1108777497 13:53784333-53784355 CACTCGATCCCCCTCAAGGCTGG - Intergenic
1109738854 13:66524541-66524563 CACTTTTTTCAGCTAAAGGGGGG + Intronic
1112212835 13:97398151-97398173 CACTCAGTCCCCCAAAAGGCTGG - Intergenic
1113210210 13:107969768-107969790 CACTGTTGACCCCTAAAGGGTGG + Intergenic
1113430989 13:110250493-110250515 CCCTTTTTCCCACTAAACGGGGG + Intronic
1113571477 13:111361293-111361315 CACTTTTTCATCCAAAAGGGCGG - Intergenic
1114940905 14:27608649-27608671 CCTTCTTTTTCCCTAAAGGGAGG - Intergenic
1117631674 14:57699674-57699696 AATTCTTTCCCCCAAAAGAGGGG - Intronic
1119974626 14:79011677-79011699 CAGTCTTTCCTCCTACAGAGCGG + Intronic
1124007787 15:25808735-25808757 CACTCTTTTCCCCCATTGGGTGG + Intronic
1125385104 15:39128940-39128962 CAGTCTTTCCACCTAATGAGTGG + Intergenic
1129521604 15:76189834-76189856 AAATCTTTCCCCCTAAAAGTGGG + Intronic
1129702576 15:77776154-77776176 ATCTCTGTCCCCATAAAGGGAGG - Intronic
1130975460 15:88769942-88769964 CACTCTTTCCTCCGAGGGGGTGG - Intergenic
1132348019 15:101120373-101120395 GAATCTTTCCCCCTAAAATGAGG + Intergenic
1137945186 16:52727086-52727108 CACACCATCCCCCTAAGGGGTGG + Intergenic
1146471788 17:33130677-33130699 CACTTTTTCCTCCTGGAGGGGGG + Intronic
1147563605 17:41523472-41523494 CACTCTGTCCCAGGAAAGGGAGG - Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1155184557 18:23375939-23375961 CACTCTCTCCTCCTAAAAGAAGG + Intronic
1156649424 18:39206867-39206889 CACTATATCCCACTAGAGGGAGG + Intergenic
1157715490 18:49883075-49883097 CAGTCTTTCACCATAAAGTGTGG - Intronic
1160919221 19:1512075-1512097 CCCTCTTTCCCCCTGCAGGCTGG - Intronic
1163762686 19:19146018-19146040 CTCTCTTTCCCCCTGCAGTGGGG - Exonic
1164920342 19:32084392-32084414 CAAGCCTTCCCCCTAAAGGCAGG + Intergenic
1165138563 19:33685898-33685920 CACTCCTTTCCCCTAAGGTGTGG - Intronic
1165339370 19:35199700-35199722 CACTGTTTCCCCCAGAAGGGAGG + Intergenic
925175723 2:1782310-1782332 CTCCCTTTCCCCTAAAAGGGCGG - Intergenic
926784484 2:16507046-16507068 CACTATTTCCCCCTATGGGATGG + Intergenic
927216207 2:20669079-20669101 CTCTGTTTCCCCCAAGAGGGAGG - Intronic
928916547 2:36477936-36477958 CACTGTTTCCCCAGAAAGGAAGG + Intronic
932865723 2:75339717-75339739 CACTTTTTCCCCTTAAATGGAGG - Intergenic
933703169 2:85270569-85270591 CACTCTTTCTTGCTAAAGGTGGG - Intronic
934523040 2:95031817-95031839 CTCTCTTCCTCTCTAAAGGGAGG + Intronic
936511861 2:113154897-113154919 CAGTCTTTCCTGCTAAGGGGTGG + Intergenic
938549895 2:132370507-132370529 CACTCAAACCCCCTTAAGGGAGG + Intergenic
940859108 2:158753943-158753965 CACTCATTCCCACCAAGGGGAGG - Intergenic
942920535 2:181367880-181367902 CGCTCTCTCCCAGTAAAGGGAGG - Intergenic
944398670 2:199300110-199300132 CACTCTTTACACCTAAAAGAAGG - Intronic
948762381 2:240199933-240199955 CAGTCTTTTCCCCTGAAGAGAGG + Intergenic
948845136 2:240679526-240679548 CTGTCTTTCCCCCCAAGGGGAGG + Intronic
948848724 2:240695353-240695375 CTGTCTTTCCCCCCAAGGGGAGG - Intronic
1169090636 20:2859579-2859601 CACTCTCTACCCCCAGAGGGAGG - Intronic
1173458016 20:43219308-43219330 CCCTGTTCCTCCCTAAAGGGGGG - Intergenic
1175171178 20:57082526-57082548 CCATCTGCCCCCCTAAAGGGAGG - Intergenic
1180602368 22:17030835-17030857 CACTCTGTCCCTCTTAAGTGGGG + Intergenic
1183484002 22:38079729-38079751 AAGTATTTCCCCCTAAAGTGTGG + Intronic
1184469702 22:44689504-44689526 CACACTTGGTCCCTAAAGGGAGG - Intronic
1184681583 22:46075054-46075076 CCCTCCGACCCCCTAAAGGGCGG + Intronic
1185361522 22:50410606-50410628 CACTCTATCCCCCAGACGGGAGG - Intronic
949890646 3:8731410-8731432 CACTCCTTCCACCAAGAGGGAGG - Intronic
950056036 3:10025681-10025703 CACTCTTCCCAACGAAAGGGTGG + Intergenic
950335745 3:12191441-12191463 CACTCTCTCAGCCTAAAGGGTGG - Intergenic
952963349 3:38606414-38606436 CACTCTTTCTCCCTGTAGGATGG - Intronic
965617705 3:170611893-170611915 CTGTCTTTTCCCCTAATGGGAGG + Intronic
968995091 4:3940355-3940377 CACTGTTTCCCCCTCAGCGGTGG - Intergenic
971991273 4:33898090-33898112 CACTCTGTCACCCTAGAGGTTGG - Intergenic
975760862 4:77618557-77618579 CACCCTTTGCCCTCAAAGGGGGG + Intergenic
978162285 4:105563130-105563152 CACCCGTTCCCCTTAAAGGAAGG - Intronic
981028639 4:140101300-140101322 AACACTTTTCCTCTAAAGGGAGG + Intronic
985571385 5:647442-647464 CACACTGTGCCCCTGAAGGGAGG - Intronic
985845595 5:2344356-2344378 CACTCTTTGCCTTTAAAGTGGGG + Intergenic
987271328 5:16312505-16312527 CACTCGTTGCTCCTACAGGGAGG + Intergenic
988378058 5:30464387-30464409 CTCTCTTTCTCCCTAATGAGGGG - Intergenic
991037055 5:62138102-62138124 GATTCTTTCCTCCTAAAGGAAGG + Intergenic
992219475 5:74557661-74557683 CACTCTTTGCCCTCAAAGGAGGG + Intergenic
998494771 5:142578564-142578586 AATTCTTTCCTCCTCAAGGGAGG + Intergenic
1000988802 5:167890305-167890327 AACTTTTTCCTCCCAAAGGGAGG + Intronic
1001123287 5:168997335-168997357 CAGTCTCTCCCTCTAAAGTGGGG - Intronic
1002059885 5:176620027-176620049 CACTCTGTCCCCCGGAAGGCAGG - Intergenic
1005948730 6:30615410-30615432 CCCCCTTTCCCTCTATAGGGAGG - Intronic
1009058428 6:58367726-58367748 CACTCTTTCCCTCAAATGGATGG - Intergenic
1009975471 6:70667089-70667111 CACACTTTCCCCCTTATGGAAGG + Intergenic
1013641247 6:112084402-112084424 CACTTTTTCAGCCTAATGGGAGG - Intronic
1021716881 7:23469384-23469406 CACTCTCTCCTCCCACAGGGTGG + Intronic
1021973719 7:25990499-25990521 CACTCTTACGTCCTGAAGGGAGG - Intergenic
1022937524 7:35194329-35194351 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1023724881 7:43132567-43132589 GACTCTCTTCCCCTAAAGGGAGG - Intronic
1028304538 7:89246752-89246774 CAATCTATGCCCATAAAGGGTGG - Intronic
1028372606 7:90111272-90111294 CCCTCTTTCCCCCCAAACCGTGG - Intergenic
1029833684 7:103286972-103286994 CCCTCTTTCCCCCCAAACCGTGG + Intergenic
1029854636 7:103503057-103503079 TATTCTTTCCAACTAAAGGGTGG - Exonic
1030869828 7:114741531-114741553 CATTCTTTCCCCCAAAATCGAGG + Intergenic
1036612294 8:10360786-10360808 CACTCTCCCCCACTAGAGGGTGG - Intronic
1038170145 8:25124041-25124063 AACTCCTTCCCCCAAAGGGGAGG - Intergenic
1041643636 8:60229375-60229397 CACTCTTGCTCCCTTCAGGGTGG + Intronic
1043116897 8:76268059-76268081 CACTCTATCTTCATAAAGGGAGG - Intergenic
1045905261 8:107337542-107337564 CTCTCTTTACTCCTTAAGGGAGG + Intronic
1046010454 8:108539982-108540004 CAGTCCTTTCCCCTATAGGGTGG - Intergenic
1046870355 8:119198741-119198763 AACTCTCTCCACCTAAATGGTGG + Intronic
1049000925 8:139825301-139825323 CACTCTTTCCCGCCGAATGGAGG + Intronic
1053113435 9:35481557-35481579 CTCTCTCTCCCTCTAAAGGCAGG - Intergenic
1061710469 9:132483861-132483883 AACTCTTTCTCCCTTAAGGATGG - Intronic
1186353796 X:8768669-8768691 TACTATTTCCCCCTAAGGAGTGG + Intergenic
1186712850 X:12218581-12218603 CACTCTCTCCCCTAAATGGGAGG + Intronic
1188094990 X:26010439-26010461 ACCTCTTCCCCCCAAAAGGGAGG + Intergenic
1194349432 X:92808258-92808280 CACTCCTCCTCCCTTAAGGGTGG + Intergenic
1194410017 X:93545901-93545923 CACTTTTTCTAACTAAAGGGTGG - Intergenic
1197596559 X:128470952-128470974 CACTATTTGCCCCTCCAGGGAGG + Intergenic
1198219709 X:134588178-134588200 CTAGCTTTCCCCCTAAAGAGGGG - Intronic
1200657756 Y:5924859-5924881 CACTCCTCCTCCCTTAAGGGTGG + Intergenic