ID: 1090688903

View in Genome Browser
Species Human (GRCh38)
Location 11:129156572-129156594
Sequence TCATCTACAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1779
Summary {0: 1, 1: 25, 2: 532, 3: 666, 4: 555}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090688903_1090688911 15 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688911 11:129156610-129156632 GGGACAGAGTACCTGTGAGAAGG 0: 1
1: 3
2: 69
3: 700
4: 984
1090688903_1090688906 -5 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688906 11:129156590-129156612 GATGAAACTCCCATCTCCCTGGG 0: 12
1: 503
2: 659
3: 461
4: 385
1090688903_1090688916 26 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688916 11:129156621-129156643 CCTGTGAGAAGGTGGGGCTGTGG 0: 1
1: 1
2: 11
3: 97
4: 1030
1090688903_1090688912 18 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688912 11:129156613-129156635 ACAGAGTACCTGTGAGAAGGTGG 0: 1
1: 0
2: 2
3: 29
4: 318
1090688903_1090688917 27 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688917 11:129156622-129156644 CTGTGAGAAGGTGGGGCTGTGGG 0: 1
1: 0
2: 3
3: 80
4: 910
1090688903_1090688905 -6 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688905 11:129156589-129156611 AGATGAAACTCCCATCTCCCTGG 0: 11
1: 491
2: 685
3: 451
4: 474
1090688903_1090688914 20 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688914 11:129156615-129156637 AGAGTACCTGTGAGAAGGTGGGG 0: 2
1: 1
2: 2
3: 62
4: 671
1090688903_1090688913 19 Left 1090688903 11:129156572-129156594 CCCAGTCAGGGGCTTGTAGATGA 0: 1
1: 25
2: 532
3: 666
4: 555
Right 1090688913 11:129156614-129156636 CAGAGTACCTGTGAGAAGGTGGG 0: 1
1: 0
2: 0
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090688903 Original CRISPR TCATCTACAAGCCCCTGACT GGG (reversed) Intronic