ID: 1090695754

View in Genome Browser
Species Human (GRCh38)
Location 11:129239775-129239797
Sequence CTGTTTGCACAGATTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090695754 Original CRISPR CTGTTTGCACAGATTGAGGA TGG (reversed) Intronic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902263695 1:15246626-15246648 ATGTTTGCAGAGATAGAGAAAGG + Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904571732 1:31471117-31471139 CTCTGTGCACAGACCGAGGAAGG - Intergenic
906112970 1:43336927-43336949 CTGTTTGCTCAGATTGGAGATGG - Intergenic
907539866 1:55204968-55204990 CTGTTTGCACATTTTTAAGAAGG - Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
910072741 1:83238649-83238671 CTGCTTCCACTGATTGTGGAAGG - Intergenic
911141125 1:94503677-94503699 CTGTTTGCATGAAGTGAGGAAGG - Intronic
911331961 1:96535030-96535052 CTGTTTGAACTGCTTGAAGATGG + Intergenic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
912716321 1:111986541-111986563 TTGCTTTCACAAATTGAGGATGG - Intronic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
915839828 1:159204968-159204990 CTGTCTGCACAGGGTGAGTATGG + Intronic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
917654409 1:177112091-177112113 CAGATTGCACATATAGAGGAGGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
922636892 1:227182787-227182809 CTGCTTGCCCACATTGAGGGTGG - Intronic
922990886 1:229910164-229910186 CTGTTTCCACACATGGTGGAAGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG + Intronic
1066089354 10:32002654-32002676 CTGTCTGCACATATTGAAGAGGG + Intergenic
1067135655 10:43605463-43605485 CTGTTTGCGCAGATTAATCAGGG - Intergenic
1068400648 10:56523350-56523372 TTGTTTGCACATATTGAAGAGGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG + Intronic
1079819149 11:25103470-25103492 CTGTTTCCTCACATTGAAGAAGG - Intergenic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1087886953 11:103492957-103492979 CTGTTTGATCAGGTTGAAGATGG + Intergenic
1088809870 11:113385048-113385070 TTGTTTGGGCAGATTGAAGATGG - Intergenic
1089855318 11:121538585-121538607 CTGTTTGCTCAAATACAGGACGG - Intronic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091033526 11:132213168-132213190 CGGTGTGCACAGATGGATGAAGG + Intronic
1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG + Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093783614 12:23166822-23166844 CTATTTAGAAAGATTGAGGAAGG + Intergenic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG + Intergenic
1101970543 12:109309450-109309472 CTGTTGGCAAAGTTTGAAGAGGG - Intergenic
1102960256 12:117088130-117088152 CTGTATGCCCAAACTGAGGAGGG + Intronic
1106814282 13:33389338-33389360 CTAATTGAACAGTTTGAGGAGGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114633657 14:24175305-24175327 CTTCTTGCACAAATTGATGAGGG + Intronic
1115762962 14:36594009-36594031 CTGAGTGCACAGCTTCAGGAGGG + Intergenic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG + Intronic
1118821468 14:69348935-69348957 CTGCTTGCACCGACTGAGGCAGG - Intronic
1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG + Intergenic
1121638493 14:95469813-95469835 CCATTTGCACACATTGGGGAAGG - Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127290402 15:57565434-57565456 CTGTTTGCTCACATCGCGGAGGG + Intergenic
1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG + Intronic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1136392204 16:29972866-29972888 ATGTGTGCAGAAATTGAGGAAGG - Intronic
1138612581 16:58138427-58138449 CTGTTTCCACACATTGCAGAAGG - Intergenic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1145818437 17:27812259-27812281 CAGTTTGCAGGCATTGAGGAAGG + Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1151354921 17:73552702-73552724 CTGACTGCAGAGCTTGAGGACGG + Intronic
1151445126 17:74158630-74158652 CTGTCTGCACTGATTTAGGCTGG + Intergenic
1155713641 18:28912517-28912539 CTGTTTGCACAGAAAGAGAGAGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1158748754 18:60233462-60233484 CTGTTTTCAAACATTTAGGATGG - Intergenic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1165695292 19:37896058-37896080 CTGTTAGCCCAGATTGACAAAGG - Intronic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167812776 19:51849115-51849137 CTATTTCCACAGTTTGGGGAAGG + Intergenic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
926730930 2:16034846-16034868 CTGTTTGGACACATTGATCAAGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928459335 2:31456248-31456270 CAGTTTGCACAGGGAGAGGAAGG + Intergenic
929050208 2:37829992-37830014 CAGTTTTCTCAGTTTGAGGAGGG - Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
940983563 2:160029500-160029522 CTGCTTCCACAGCTTGAGGTGGG + Intronic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG + Intergenic
943258611 2:185629494-185629516 CCTTTTGCACAGAGAGAGGAAGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1172250361 20:33475218-33475240 CTGTTTGCTCAAATTGTGCATGG - Intergenic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1176185448 20:63775881-63775903 CTCTATGCACAGGTGGAGGAGGG - Exonic
1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG + Intergenic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1180713223 22:17854205-17854227 CTGTTGACACAGCTTGGGGAGGG + Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
951702662 3:25511791-25511813 CTCTGTGCACAACTTGAGGATGG + Intronic
952212515 3:31242495-31242517 CTGTTTGACCATATTGAGAAGGG - Intergenic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
957146775 3:76434769-76434791 CTGTTTGCGCAGATTAATCAGGG + Intronic
959557844 3:107742828-107742850 CTGTTTGCAAATCTTTAGGATGG - Intronic
960515977 3:118603243-118603265 AAGTTTCCACAGACTGAGGAAGG - Intergenic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
967102570 3:186228458-186228480 CTTTTTGAACAGATTAATGAAGG - Intronic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974247818 4:59343990-59344012 CTGTTTGCACAAAGTGACTAAGG + Intergenic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
979937356 4:126715040-126715062 CTGTTTTCTCAGCATGAGGAAGG - Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
986073650 5:4312465-4312487 CTGTTTGCACAGTGAAAGGAAGG - Intergenic
989705894 5:44329829-44329851 TTGTTTGCCCAGATTCAGTAGGG - Intronic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992130655 5:73689244-73689266 CTGTTTGCTCATTTTTAGGAAGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG + Intergenic
999809481 5:155114595-155114617 TTCTTTGCACTGGTTGAGGATGG - Intergenic
1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1002015989 5:176323232-176323254 GCATTTGGACAGATTGAGGAAGG + Intronic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1004002400 6:11607266-11607288 CAGTTTGCACCGATTGGGGCAGG + Intergenic
1004515400 6:16318215-16318237 CTGTTTTCACAAATTGCGAAGGG + Intronic
1005581743 6:27241749-27241771 CTGCTTGCACACACAGAGGAGGG - Intergenic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG + Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1015543799 6:134342302-134342324 CTCTCTGCACAGCTTGAGGTTGG - Intergenic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1023709224 7:42974248-42974270 CAGTTTGCACTGTGTGAGGATGG + Intergenic
1024445761 7:49476622-49476644 CTGGTTTCACAGAATGAGTAAGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1024809563 7:53192027-53192049 CTGTTTGCACAGCTTCATGCTGG - Intergenic
1027290469 7:76703803-76703825 CTGCTTCCACTGATTGTGGAAGG - Intergenic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1031936600 7:127741618-127741640 ATGTTAGCAAAGAGTGAGGAAGG - Intronic
1031940105 7:127779549-127779571 CTGTTTGCTCCGATTTAGAATGG + Intronic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1034258173 7:149735833-149735855 GTGCTTGCACAGAATCAGGAAGG + Intergenic
1036963423 8:13270582-13270604 CTGATTCCACACATTGATGAGGG - Intronic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1038388912 8:27176318-27176340 CAGTGAGCAGAGATTGAGGAAGG + Intergenic
1039234670 8:35488777-35488799 CTGGTTTCACAGATTGGCGATGG + Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1052636517 9:31113153-31113175 CTGCTTGCACAGATTGCTGCTGG - Intergenic
1057547920 9:96031873-96031895 CTGTTTACACGGACTCAGGACGG - Intergenic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1059322659 9:113481547-113481569 CTGTTTGCACAGCTGGAGTCAGG - Intronic
1060030069 9:120206893-120206915 CTCTTTGTACAGATTTAGGTGGG - Intergenic
1060957194 9:127650612-127650634 CTGTTTTTAGAGCTTGAGGAGGG + Intronic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1193104016 X:77648659-77648681 CTTTTTGCACAGATTAATCAAGG + Intronic
1193555493 X:82948932-82948954 CTCTTTGCAGAGATTGTGAATGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1196199745 X:112872102-112872124 CTGTTTACACAAAAGGAGGAGGG - Intergenic
1196810768 X:119627465-119627487 GTCATTCCACAGATTGAGGATGG + Intronic
1198047025 X:132913365-132913387 CTGTTTGCTCAGGCTGTGGATGG + Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic