ID: 1090702538

View in Genome Browser
Species Human (GRCh38)
Location 11:129309544-129309566
Sequence CTGTGTGTCACATGGCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090702531_1090702538 5 Left 1090702531 11:129309516-129309538 CCAATTATGTTGGAAGGTGAAGG No data
Right 1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG No data
1090702528_1090702538 18 Left 1090702528 11:129309503-129309525 CCTCAGGAAGCTTCCAATTATGT No data
Right 1090702538 11:129309544-129309566 CTGTGTGTCACATGGCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090702538 Original CRISPR CTGTGTGTCACATGGCAAAA GGG Intergenic
No off target data available for this crispr