ID: 1090709372

View in Genome Browser
Species Human (GRCh38)
Location 11:129372322-129372344
Sequence AAAACCTACTTCACAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709372_1090709378 20 Left 1090709372 11:129372322-129372344 CCCATCCTTGTGAAGTAGGTTTT No data
Right 1090709378 11:129372365-129372387 AAAAAACTGAGGCTCAGCTTAGG No data
1090709372_1090709377 9 Left 1090709372 11:129372322-129372344 CCCATCCTTGTGAAGTAGGTTTT No data
Right 1090709377 11:129372354-129372376 ATTTACAAATGAAAAAACTGAGG No data
1090709372_1090709379 21 Left 1090709372 11:129372322-129372344 CCCATCCTTGTGAAGTAGGTTTT No data
Right 1090709379 11:129372366-129372388 AAAAACTGAGGCTCAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709372 Original CRISPR AAAACCTACTTCACAAGGAT GGG (reversed) Intergenic