ID: 1090709584

View in Genome Browser
Species Human (GRCh38)
Location 11:129373444-129373466
Sequence GCGGTCAAAGCGCGGGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709584_1090709602 22 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709602 11:129373489-129373511 GCGGAAGCAGGGGGCGCGCCTGG No data
1090709584_1090709604 24 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709604 11:129373491-129373513 GGAAGCAGGGGGCGCGCCTGGGG No data
1090709584_1090709590 -8 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709590 11:129373459-129373481 TTGACCGCGGACCAGCCTCAGGG No data
1090709584_1090709596 11 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709596 11:129373478-129373500 AGGGTCCCGCCGCGGAAGCAGGG No data
1090709584_1090709593 3 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709593 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
1090709584_1090709595 10 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709595 11:129373477-129373499 CAGGGTCCCGCCGCGGAAGCAGG No data
1090709584_1090709603 23 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709584_1090709597 12 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709597 11:129373479-129373501 GGGTCCCGCCGCGGAAGCAGGGG No data
1090709584_1090709589 -9 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709589 11:129373458-129373480 TTTGACCGCGGACCAGCCTCAGG No data
1090709584_1090709598 13 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709584 Original CRISPR GCGGTCAAAGCGCGGGACCC GGG (reversed) Intergenic
No off target data available for this crispr