ID: 1090709588

View in Genome Browser
Species Human (GRCh38)
Location 11:129373452-129373474
Sequence GCTGGTCCGCGGTCAAAGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709588_1090709598 5 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709588_1090709593 -5 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709593 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
1090709588_1090709602 14 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709602 11:129373489-129373511 GCGGAAGCAGGGGGCGCGCCTGG No data
1090709588_1090709597 4 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709597 11:129373479-129373501 GGGTCCCGCCGCGGAAGCAGGGG No data
1090709588_1090709595 2 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709595 11:129373477-129373499 CAGGGTCCCGCCGCGGAAGCAGG No data
1090709588_1090709596 3 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709596 11:129373478-129373500 AGGGTCCCGCCGCGGAAGCAGGG No data
1090709588_1090709603 15 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709588_1090709604 16 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709604 11:129373491-129373513 GGAAGCAGGGGGCGCGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709588 Original CRISPR GCTGGTCCGCGGTCAAAGCG CGG (reversed) Intergenic