ID: 1090709590

View in Genome Browser
Species Human (GRCh38)
Location 11:129373459-129373481
Sequence TTGACCGCGGACCAGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709584_1090709590 -8 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709590 11:129373459-129373481 TTGACCGCGGACCAGCCTCAGGG No data
1090709581_1090709590 14 Left 1090709581 11:129373422-129373444 CCAGGGCTGAGCGGTGAGCTGTC No data
Right 1090709590 11:129373459-129373481 TTGACCGCGGACCAGCCTCAGGG No data
1090709585_1090709590 -9 Left 1090709585 11:129373445-129373467 CCGGGTCCCGCGCTTTGACCGCG No data
Right 1090709590 11:129373459-129373481 TTGACCGCGGACCAGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709590 Original CRISPR TTGACCGCGGACCAGCCTCA GGG Intergenic