ID: 1090709591

View in Genome Browser
Species Human (GRCh38)
Location 11:129373463-129373485
Sequence GGGACCCTGAGGCTGGTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709591_1090709596 -8 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709596 11:129373478-129373500 AGGGTCCCGCCGCGGAAGCAGGG No data
1090709591_1090709598 -6 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709591_1090709602 3 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709602 11:129373489-129373511 GCGGAAGCAGGGGGCGCGCCTGG No data
1090709591_1090709597 -7 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709597 11:129373479-129373501 GGGTCCCGCCGCGGAAGCAGGGG No data
1090709591_1090709604 5 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709604 11:129373491-129373513 GGAAGCAGGGGGCGCGCCTGGGG No data
1090709591_1090709603 4 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709591_1090709595 -9 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709595 11:129373477-129373499 CAGGGTCCCGCCGCGGAAGCAGG No data
1090709591_1090709607 30 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709591 Original CRISPR GGGACCCTGAGGCTGGTCCG CGG (reversed) Intergenic
No off target data available for this crispr