ID: 1090709592

View in Genome Browser
Species Human (GRCh38)
Location 11:129373470-129373492
Sequence CCGCGGCGGGACCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709592_1090709607 23 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709592_1090709603 -3 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709592_1090709602 -4 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709602 11:129373489-129373511 GCGGAAGCAGGGGGCGCGCCTGG No data
1090709592_1090709604 -2 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709604 11:129373491-129373513 GGAAGCAGGGGGCGCGCCTGGGG No data
1090709592_1090709609 26 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709609 11:129373519-129373541 CTGTAGACCCCAGAGTCCGGCGG No data
1090709592_1090709610 30 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709610 11:129373523-129373545 AGACCCCAGAGTCCGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709592 Original CRISPR CCGCGGCGGGACCCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr