ID: 1090709598

View in Genome Browser
Species Human (GRCh38)
Location 11:129373480-129373502
Sequence GGTCCCGCCGCGGAAGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709591_1090709598 -6 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709587_1090709598 6 Left 1090709587 11:129373451-129373473 CCCGCGCTTTGACCGCGGACCAG No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709585_1090709598 12 Left 1090709585 11:129373445-129373467 CCGGGTCCCGCGCTTTGACCGCG No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709584_1090709598 13 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data
1090709588_1090709598 5 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709598 11:129373480-129373502 GGTCCCGCCGCGGAAGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709598 Original CRISPR GGTCCCGCCGCGGAAGCAGG GGG Intergenic