ID: 1090709600

View in Genome Browser
Species Human (GRCh38)
Location 11:129373484-129373506
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709600_1090709607 9 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709600_1090709609 12 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709609 11:129373519-129373541 CTGTAGACCCCAGAGTCCGGCGG No data
1090709600_1090709614 24 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709600_1090709610 16 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709610 11:129373523-129373545 AGACCCCAGAGTCCGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709600 Original CRISPR CGCGCCCCCTGCTTCCGCGG CGG (reversed) Intergenic