ID: 1090709603

View in Genome Browser
Species Human (GRCh38)
Location 11:129373490-129373512
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709585_1090709603 22 Left 1090709585 11:129373445-129373467 CCGGGTCCCGCGCTTTGACCGCG No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709592_1090709603 -3 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709594_1090709603 -7 Left 1090709594 11:129373474-129373496 CCTCAGGGTCCCGCCGCGGAAGC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709591_1090709603 4 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709584_1090709603 23 Left 1090709584 11:129373444-129373466 CCCGGGTCCCGCGCTTTGACCGC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709588_1090709603 15 Left 1090709588 11:129373452-129373474 CCGCGCTTTGACCGCGGACCAGC No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data
1090709587_1090709603 16 Left 1090709587 11:129373451-129373473 CCCGCGCTTTGACCGCGGACCAG No data
Right 1090709603 11:129373490-129373512 CGGAAGCAGGGGGCGCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709603 Original CRISPR CGGAAGCAGGGGGCGCGCCT GGG Intergenic