ID: 1090709605

View in Genome Browser
Species Human (GRCh38)
Location 11:129373507-129373529
Sequence GGGGTCTACAGGCTGGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709605_1090709610 -7 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709610 11:129373523-129373545 AGACCCCAGAGTCCGGCGGCAGG No data
1090709605_1090709620 19 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709620 11:129373549-129373571 CCCGGCGCCACCCGGACACCTGG No data
1090709605_1090709616 11 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709605_1090709614 1 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709605 Original CRISPR GGGGTCTACAGGCTGGCCCC AGG (reversed) Intergenic
No off target data available for this crispr