ID: 1090709606

View in Genome Browser
Species Human (GRCh38)
Location 11:129373514-129373536
Sequence GGACTCTGGGGTCTACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709606_1090709614 -6 Left 1090709606 11:129373514-129373536 CCAGCCTGTAGACCCCAGAGTCC No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709606_1090709620 12 Left 1090709606 11:129373514-129373536 CCAGCCTGTAGACCCCAGAGTCC No data
Right 1090709620 11:129373549-129373571 CCCGGCGCCACCCGGACACCTGG No data
1090709606_1090709616 4 Left 1090709606 11:129373514-129373536 CCAGCCTGTAGACCCCAGAGTCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709606 Original CRISPR GGACTCTGGGGTCTACAGGC TGG (reversed) Intergenic