ID: 1090709606 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:129373514-129373536 |
| Sequence | GGACTCTGGGGTCTACAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1090709606_1090709614 | -6 | Left | 1090709606 | 11:129373514-129373536 | CCAGCCTGTAGACCCCAGAGTCC | No data | ||
| Right | 1090709614 | 11:129373531-129373553 | GAGTCCGGCGGCAGGACCCCCGG | No data | ||||
| 1090709606_1090709620 | 12 | Left | 1090709606 | 11:129373514-129373536 | CCAGCCTGTAGACCCCAGAGTCC | No data | ||
| Right | 1090709620 | 11:129373549-129373571 | CCCGGCGCCACCCGGACACCTGG | No data | ||||
| 1090709606_1090709616 | 4 | Left | 1090709606 | 11:129373514-129373536 | CCAGCCTGTAGACCCCAGAGTCC | No data | ||
| Right | 1090709616 | 11:129373541-129373563 | GCAGGACCCCCGGCGCCACCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1090709606 | Original CRISPR | GGACTCTGGGGTCTACAGGC TGG (reversed) | Intergenic | ||