ID: 1090709607

View in Genome Browser
Species Human (GRCh38)
Location 11:129373516-129373538
Sequence AGCCTGTAGACCCCAGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709592_1090709607 23 Left 1090709592 11:129373470-129373492 CCAGCCTCAGGGTCCCGCCGCGG No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709594_1090709607 19 Left 1090709594 11:129373474-129373496 CCTCAGGGTCCCGCCGCGGAAGC No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709599_1090709607 10 Left 1090709599 11:129373483-129373505 CCCGCCGCGGAAGCAGGGGGCGC No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709591_1090709607 30 Left 1090709591 11:129373463-129373485 CCGCGGACCAGCCTCAGGGTCCC No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709600_1090709607 9 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data
1090709601_1090709607 6 Left 1090709601 11:129373487-129373509 CCGCGGAAGCAGGGGGCGCGCCT No data
Right 1090709607 11:129373516-129373538 AGCCTGTAGACCCCAGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709607 Original CRISPR AGCCTGTAGACCCCAGAGTC CGG Intergenic
No off target data available for this crispr