ID: 1090709614

View in Genome Browser
Species Human (GRCh38)
Location 11:129373531-129373553
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709605_1090709614 1 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709608_1090709614 -10 Left 1090709608 11:129373518-129373540 CCTGTAGACCCCAGAGTCCGGCG No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709606_1090709614 -6 Left 1090709606 11:129373514-129373536 CCAGCCTGTAGACCCCAGAGTCC No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709600_1090709614 24 Left 1090709600 11:129373484-129373506 CCGCCGCGGAAGCAGGGGGCGCG No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709601_1090709614 21 Left 1090709601 11:129373487-129373509 CCGCGGAAGCAGGGGGCGCGCCT No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data
1090709599_1090709614 25 Left 1090709599 11:129373483-129373505 CCCGCCGCGGAAGCAGGGGGCGC No data
Right 1090709614 11:129373531-129373553 GAGTCCGGCGGCAGGACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709614 Original CRISPR GAGTCCGGCGGCAGGACCCC CGG Intergenic