ID: 1090709616

View in Genome Browser
Species Human (GRCh38)
Location 11:129373541-129373563
Sequence GCAGGACCCCCGGCGCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090709611_1090709616 -8 Left 1090709611 11:129373526-129373548 CCCCAGAGTCCGGCGGCAGGACC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709605_1090709616 11 Left 1090709605 11:129373507-129373529 CCTGGGGCCAGCCTGTAGACCCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709612_1090709616 -9 Left 1090709612 11:129373527-129373549 CCCAGAGTCCGGCGGCAGGACCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709613_1090709616 -10 Left 1090709613 11:129373528-129373550 CCAGAGTCCGGCGGCAGGACCCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709606_1090709616 4 Left 1090709606 11:129373514-129373536 CCAGCCTGTAGACCCCAGAGTCC No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data
1090709608_1090709616 0 Left 1090709608 11:129373518-129373540 CCTGTAGACCCCAGAGTCCGGCG No data
Right 1090709616 11:129373541-129373563 GCAGGACCCCCGGCGCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090709616 Original CRISPR GCAGGACCCCCGGCGCCACC CGG Intergenic