ID: 1090710713

View in Genome Browser
Species Human (GRCh38)
Location 11:129382501-129382523
Sequence GCTCGTGAACGTGCATGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090710711_1090710713 1 Left 1090710711 11:129382477-129382499 CCGAGGCCTCTTAATTTGTACTG 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG 0: 1
1: 0
2: 1
3: 2
4: 34
1090710709_1090710713 6 Left 1090710709 11:129382472-129382494 CCCAGCCGAGGCCTCTTAATTTG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG 0: 1
1: 0
2: 1
3: 2
4: 34
1090710708_1090710713 14 Left 1090710708 11:129382464-129382486 CCACTGCACCCAGCCGAGGCCTC 0: 1
1: 4
2: 40
3: 357
4: 2339
Right 1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG 0: 1
1: 0
2: 1
3: 2
4: 34
1090710712_1090710713 -5 Left 1090710712 11:129382483-129382505 CCTCTTAATTTGTACTGAGCTCG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG 0: 1
1: 0
2: 1
3: 2
4: 34
1090710710_1090710713 5 Left 1090710710 11:129382473-129382495 CCAGCCGAGGCCTCTTAATTTGT 0: 1
1: 0
2: 0
3: 6
4: 201
Right 1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG 0: 1
1: 0
2: 1
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090710713 Original CRISPR GCTCGTGAACGTGCATGCTA TGG Intronic
906791937 1:48666513-48666535 GTGTGTGCACGTGCATGCTAAGG - Intronic
910030917 1:82721709-82721731 GCCACTGAACGTGCATGCTGTGG - Intergenic
912417045 1:109516365-109516387 GCTTGTGAACTTGACTGCTATGG - Intergenic
913511810 1:119569128-119569150 GCTTGTGCATGTGCCTGCTAGGG + Intergenic
918067429 1:181110737-181110759 GCTCTTGAACGTGTCAGCTAAGG - Intergenic
922851945 1:228739978-228740000 GCTCGTGAAGGAGCAAGCAAAGG + Intronic
1068634919 10:59338233-59338255 GCTCTTGCCAGTGCATGCTAAGG + Intronic
1070162635 10:73874856-73874878 GCTCGGGAACGTGCATGCGAGGG + Intergenic
1076077230 10:127544041-127544063 GCTCCTGAATCTGCATGCTGGGG + Intergenic
1080451640 11:32383117-32383139 GCTGGTGCAGGTTCATGCTAGGG + Intergenic
1090710713 11:129382501-129382523 GCTCGTGAACGTGCATGCTATGG + Intronic
1092735520 12:11578918-11578940 GCATGTGAATGTGCATGGTATGG - Intergenic
1137553489 16:49455892-49455914 GCTCCTGCATGGGCATGCTAGGG - Intergenic
1142846777 17:2684597-2684619 GCTCTTGAGAGTGCATGCCATGG + Exonic
1163598185 19:18232633-18232655 GCTCCTGTACGTTCATGCTTGGG - Intronic
1166411873 19:42560922-42560944 GCACGTGCACGTGCATGCATGGG + Intronic
933372633 2:81435966-81435988 GATTGTGCAGGTGCATGCTATGG - Intergenic
1170814463 20:19701229-19701251 GCTGGTGAAAGTGAATGCAAAGG - Intronic
1179818785 21:43924516-43924538 GTTCGTGAAAGTGCTTGCAAAGG - Intronic
952625672 3:35399831-35399853 GCTTATGAAAGTGCATCCTATGG - Intergenic
953906499 3:46870977-46870999 GCGCGTGAACATGCATGCAAAGG - Intronic
956574482 3:70736663-70736685 GCACGTGCACATGCGTGCTAGGG - Intergenic
961557061 3:127702997-127703019 GCTCTTAAAAGTGGATGCTAGGG - Intronic
969506758 4:7592911-7592933 CCACTTGAAGGTGCATGCTATGG + Intronic
984197122 4:176671676-176671698 GCACGTGAATGTGCCTGCCAGGG + Intergenic
997661946 5:135595895-135595917 GCTTGTGATCGTGCCTGCTAGGG - Intergenic
999702344 5:154239478-154239500 TATGGTGAACGTGCATGCAAGGG + Intronic
1002679197 5:180948149-180948171 GATCAGGAAGGTGCATGCTAAGG - Intronic
1002685070 5:181003650-181003672 GATCAGGAAGGTGCATGCTAAGG - Intronic
1002764077 6:224797-224819 GCCCCCGAAGGTGCATGCTACGG - Intergenic
1022645023 7:32221678-32221700 GGTTGTGAAAATGCATGCTATGG + Intronic
1023520212 7:41042927-41042949 GCTCATGAACGTGTAAGCAAAGG - Intergenic
1035973588 8:4281930-4281952 GCTGGTGAATGTGCCTGTTAGGG + Intronic
1048958326 8:139555130-139555152 CCTCCTGGACGTGCAAGCTAAGG - Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1186286265 X:8046899-8046921 GCTTGTGTATGTGCCTGCTAAGG + Intergenic
1186515971 X:10166375-10166397 GCTGCTGCACGTGCTTGCTAGGG - Intronic
1198821242 X:140650590-140650612 CCTCTTGAACCTGCAGGCTAGGG + Intergenic