ID: 1090711138

View in Genome Browser
Species Human (GRCh38)
Location 11:129386862-129386884
Sequence AGGCAGACAGGAGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2614
Summary {0: 1, 1: 0, 2: 2, 3: 146, 4: 2465}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090711138_1090711143 16 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711143 11:129386901-129386923 AAATAAACAAATTAAAGCTCTGG 0: 1
1: 0
2: 7
3: 125
4: 1273
1090711138_1090711147 22 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711147 11:129386907-129386929 ACAAATTAAAGCTCTGGAGGGGG 0: 1
1: 0
2: 0
3: 23
4: 271
1090711138_1090711145 20 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711145 11:129386905-129386927 AAACAAATTAAAGCTCTGGAGGG 0: 1
1: 0
2: 3
3: 31
4: 401
1090711138_1090711146 21 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711146 11:129386906-129386928 AACAAATTAAAGCTCTGGAGGGG 0: 1
1: 0
2: 2
3: 27
4: 318
1090711138_1090711148 23 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711148 11:129386908-129386930 CAAATTAAAGCTCTGGAGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 185
1090711138_1090711144 19 Left 1090711138 11:129386862-129386884 CCTGCCACCACTCCTGTCTGCCT 0: 1
1: 0
2: 2
3: 146
4: 2465
Right 1090711144 11:129386904-129386926 TAAACAAATTAAAGCTCTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090711138 Original CRISPR AGGCAGACAGGAGTGGTGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr