ID: 1090717654

View in Genome Browser
Species Human (GRCh38)
Location 11:129444366-129444388
Sequence TTGAAAACCCTTTCATTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090717654_1090717658 -7 Left 1090717654 11:129444366-129444388 CCCTGAAATGAAAGGGTTTTCAA 0: 1
1: 0
2: 1
3: 28
4: 271
Right 1090717658 11:129444382-129444404 TTTTCAAAATGGAGGCGACTTGG 0: 1
1: 0
2: 0
3: 9
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090717654 Original CRISPR TTGAAAACCCTTTCATTTCA GGG (reversed) Intronic
909569259 1:77089172-77089194 TAGGAAAGCCTTTCAATTCATGG - Exonic
909716829 1:78718274-78718296 TAGAAAACAATTCCATTTCAAGG - Intergenic
910083065 1:83364778-83364800 TTGTAAACCATTGCATTTCAAGG + Intergenic
911319696 1:96397982-96398004 TTGATAAATCTTCCATTTCATGG - Intergenic
913302819 1:117390150-117390172 TGGAAAACCAACTCATTTCATGG - Intronic
915867333 1:159517017-159517039 TTGAACTCCCTTTCAATTGAGGG - Intergenic
916016130 1:160751211-160751233 CTGAAAACCCTTCCATTACAAGG + Intronic
916912102 1:169361853-169361875 CTGAAAAGCATTTCATTTCATGG + Intronic
917798085 1:178546377-178546399 ATGATAAACTTTTCATTTCATGG - Intronic
917951478 1:180041640-180041662 TTTAAACCCCTTTTATTTAAAGG + Exonic
918410193 1:184250337-184250359 ATGAAATCCCTTTTAGTTCATGG - Intergenic
919513107 1:198490939-198490961 TAGCAGACCCTTTCATTCCAGGG - Intergenic
919544868 1:198902996-198903018 TTCAGAACCCTTTGATTTAATGG + Intergenic
919964282 1:202505886-202505908 TTCAAAACCCTTTCATTCTGGGG - Intronic
923345028 1:233043334-233043356 TTGAAAACCCTTGAACTTGATGG + Intronic
923590541 1:235314979-235315001 TTGATAACCTTTTGATTTCAGGG - Intronic
1064523141 10:16224851-16224873 TTGAAAACTGTTTCATTCAATGG + Intergenic
1064526792 10:16265209-16265231 TTGGAAACAGTTTCATTCCATGG + Intergenic
1064857080 10:19781164-19781186 TTGAAAGCCTTATCATTTTAGGG + Intronic
1067819503 10:49515662-49515684 TTGAATACCATTTCTTTCCACGG + Exonic
1068929177 10:62571394-62571416 TTCCCAAACCTTTCATTTCATGG - Intronic
1071930183 10:90460807-90460829 TTGAGAATCCTTTTATCTCAAGG - Intergenic
1072275393 10:93817535-93817557 ATGAAAACCCTTTCTGTTCATGG + Intergenic
1073104635 10:101025505-101025527 ATAAAATCCCTTCCATTTCAAGG - Intronic
1079923758 11:26466493-26466515 TTGAAGACCTTTTGAGTTCAAGG - Intronic
1080962607 11:37178092-37178114 GTGACAACCCTTACCTTTCATGG - Intergenic
1081438317 11:43053119-43053141 GTGAAATCGCTTTGATTTCAGGG - Intergenic
1083965662 11:66042403-66042425 ATGAGAGCCCTTTCTTTTCAAGG - Exonic
1084347897 11:68568550-68568572 TTGAAAACCCTTGTACTTCCAGG + Intronic
1084921722 11:72476177-72476199 TTCAAACTCCTTTCTTTTCATGG + Intergenic
1086994322 11:93339360-93339382 TTGGAAACCATTTCATTGCATGG - Intronic
1087600057 11:100302871-100302893 TTGAAAAACATGTCAATTCAAGG - Intronic
1088161723 11:106879817-106879839 TTTCAAATCTTTTCATTTCATGG - Intronic
1090717654 11:129444366-129444388 TTGAAAACCCTTTCATTTCAGGG - Intronic
1091530111 12:1346528-1346550 CTGACAAACCTTTCATTTCTAGG + Intronic
1091873494 12:3914663-3914685 ATGTAAACCGTTTCAGTTCAGGG + Intergenic
1093640690 12:21524065-21524087 TTGGGAAACCTTTCATTTCTAGG - Intergenic
1094193468 12:27720757-27720779 TTGAAAACCTATTGATTTCTAGG + Intronic
1094502451 12:31033444-31033466 TTGAAAACGTTTTGATTTCCTGG - Intergenic
1095143950 12:38701051-38701073 TTAAAAATCCTCTCATTGCAAGG + Intronic
1095342107 12:41102857-41102879 CTTAAATCCCTTTCTTTTCATGG - Intergenic
1096690589 12:53318914-53318936 TTGAAAAGCCATTCATTCCCAGG - Intronic
1099453147 12:82832132-82832154 TTAATAACCATTTCTTTTCACGG + Intronic
1100031239 12:90194270-90194292 TTCAAAACCCTCTCATCTAAAGG - Intergenic
1101159799 12:101961990-101962012 TTGCAATTCCTTTCATCTCAAGG + Intronic
1101784580 12:107872101-107872123 TTCAAGACGCTTTCATGTCATGG + Intergenic
1104597028 12:130126881-130126903 AGGAAAACCTTTCCATTTCAGGG - Intergenic
1105307523 13:19179582-19179604 ATGTAGACCCATTCATTTCAAGG + Intronic
1105483832 13:20806096-20806118 TTAAAAAGCAGTTCATTTCAGGG - Intronic
1105661613 13:22502087-22502109 ATGTAAACACTTTCATTTCTTGG + Intergenic
1106245419 13:27945485-27945507 TTGAAAAGGATCTCATTTCATGG + Exonic
1106246784 13:27956925-27956947 TTGAAAATCATTTCATCTCAGGG + Intergenic
1107055983 13:36103979-36104001 TTGAAAGCACTTTCATTTTGTGG - Intronic
1107221101 13:37981687-37981709 TTTACAAACTTTTCATTTCATGG - Intergenic
1109505061 13:63289105-63289127 TTGAAATACCTATCAATTCAGGG - Intergenic
1109633506 13:65084296-65084318 TAGAAAACCTTTTCATCTCTAGG + Intergenic
1110644722 13:77869188-77869210 TTGAAAAACTTTTCATTTTGAGG + Intergenic
1110851291 13:80248011-80248033 TGCACAGCCCTTTCATTTCATGG - Intergenic
1111181813 13:84678916-84678938 ATGAAAAGCCTTTCATTTCAAGG + Intergenic
1111207081 13:85025156-85025178 TTCAAAACCTCTTCATTTCCAGG + Intergenic
1112624794 13:101092100-101092122 ATGACAACCTTTTCAATTCAAGG - Intronic
1112654273 13:101433112-101433134 CTGAAAATCTTTTCATTTCTTGG - Intergenic
1114593825 14:23894101-23894123 TTCCACATCCTTTCATTTCAGGG + Intergenic
1114962149 14:27906066-27906088 TTTAAAATGTTTTCATTTCAAGG + Intergenic
1115197805 14:30820512-30820534 GTCGGAACCCTTTCATTTCATGG + Intergenic
1115223914 14:31084499-31084521 TTGAAAAGCCTTCCATTTAGTGG + Intronic
1115802217 14:37007813-37007835 TTAAAAACTCTCCCATTTCAAGG + Intronic
1115824541 14:37253003-37253025 TTTCAAAACCTTTAATTTCAAGG - Intronic
1115862501 14:37703543-37703565 ATGAATACCTTTTCATTTGATGG + Intronic
1117126343 14:52630761-52630783 TTAAAAATCCATTAATTTCAGGG - Intronic
1119033418 14:71210285-71210307 TTGCAAGTCCTTTCATTTTATGG + Intergenic
1119144430 14:72298287-72298309 TTAAACAGCCTTTCATTCCAGGG + Intronic
1119230680 14:72976972-72976994 TCCAAAACCTTTTCCTTTCATGG - Intronic
1120589526 14:86359052-86359074 TTGGACAACCGTTCATTTCATGG + Intergenic
1121258300 14:92548190-92548212 TTGAATACCCTTTCTTTGCCAGG + Intronic
1121300301 14:92865177-92865199 TTGAAAACCCCTGCATTAGATGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1123895323 15:24823334-24823356 TTCTAAATCCTTTTATTTCAAGG - Intergenic
1125065658 15:35482898-35482920 TTGCAAACTGTTTCAGTTCATGG - Intronic
1126995427 15:54437842-54437864 TTAAAATCCTTTTAATTTCATGG - Intronic
1128908512 15:71490956-71490978 TTGGAAACCCTTTCTATTAAGGG - Intronic
1129492573 15:75943269-75943291 ATGAAAACCCTTTAAATGCAAGG - Exonic
1130244152 15:82227855-82227877 TAGATAACTGTTTCATTTCAAGG - Intronic
1130456299 15:84113280-84113302 TAGATAACTGTTTCATTTCAAGG + Intergenic
1130793499 15:87182035-87182057 CTGGAAAGCCTTTTATTTCATGG + Intergenic
1132077520 15:98834755-98834777 ATGAAAACCCTTCCATGTCCAGG - Intronic
1132105280 15:99058857-99058879 TGGAAAACCGTTTCAGTTCGAGG - Intergenic
1134532826 16:14997981-14998003 TTCAAAATCCTTTAATTACAAGG - Intronic
1135491771 16:22915565-22915587 TTGAGAGCCCTTTCCTTTCGTGG - Exonic
1135842762 16:25891670-25891692 TTAACATCCCTTTCATTTGAGGG - Intronic
1137228841 16:46542064-46542086 TTCAACACCCTTTCATGTTAAGG - Intergenic
1138405003 16:56785125-56785147 CCTAAAACTCTTTCATTTCAAGG - Intronic
1139240173 16:65383433-65383455 TTGCAAAACCATTCATTTCCAGG - Intergenic
1139863211 16:70042753-70042775 TTCAAAATCCTTTAATTACAAGG + Intergenic
1141276765 16:82595390-82595412 CTGAAAACCCTTTCACCTCAAGG - Intergenic
1141814932 16:86403366-86403388 AAAAAAATCCTTTCATTTCAGGG - Intergenic
1142550584 17:736304-736326 TAGAAAACCATTTCGTTTTATGG - Intronic
1143212987 17:5203300-5203322 TTGAAATCGCTTTGACTTCAAGG - Intergenic
1143627052 17:8116598-8116620 TGCAAAACCCTCGCATTTCAGGG + Intronic
1145179728 17:20736501-20736523 TTGATCTCCCTTTCATTTCCAGG - Intergenic
1145202641 17:20960597-20960619 TTTAAAAACTTTTCAGTTCAGGG + Intergenic
1145989386 17:29069760-29069782 TTGAAAACCCATTTCTTTTAAGG + Intergenic
1146492820 17:33294199-33294221 TGGAAAACCCCTTTATCTCATGG - Intronic
1148982098 17:51586004-51586026 TTAAAAAACTTTTAATTTCAGGG + Intergenic
1149791976 17:59486293-59486315 TAGAAAACACTTTACTTTCAAGG - Intergenic
1150325904 17:64257330-64257352 AAGAAAAGCCTTTCCTTTCAAGG + Intronic
1151147962 17:72058680-72058702 TTGGAAATCCTCTGATTTCAGGG + Intergenic
1152976809 18:229019-229041 TTGGAAAGCATTTCATTTCTTGG + Intronic
1153493305 18:5671720-5671742 TTGAGAACAGTTTCCTTTCAGGG + Intergenic
1153984377 18:10339927-10339949 TAGAAGTCCCCTTCATTTCATGG + Intergenic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1157787237 18:50494901-50494923 ATGAAAACCCTTTGATCTCAGGG + Intergenic
1157970624 18:52263515-52263537 TTGGCAAACCTTTTATTTCAAGG + Intergenic
1158035392 18:53022763-53022785 TTGATAAGCCTTTCTTTTCTGGG + Intronic
1158698993 18:59729745-59729767 TAGACAAGCCTTTTATTTCAGGG + Intergenic
1159278533 18:66252215-66252237 TTGACAAGCCTGTTATTTCAAGG - Intergenic
1159543178 18:69806100-69806122 TTTAAATCCCTTTCTTTTCTGGG + Intronic
1163199554 19:15755362-15755384 TTGAACATCCCTGCATTTCAGGG + Intergenic
1164388985 19:27801331-27801353 TTGAACACTCTTACATCTCACGG + Intergenic
1165250213 19:34526266-34526288 TTGAAACATCTTTCATTTCAGGG + Intergenic
1165644954 19:37427759-37427781 TTAAAAACCCCTGGATTTCAGGG - Intronic
926173862 2:10571743-10571765 AGGATAAACCTTTCATTTCATGG + Exonic
928922084 2:36536819-36536841 TTAAAAACAGCTTCATTTCATGG - Intronic
929524559 2:42688514-42688536 TTGAAAAACATTTCACATCAAGG - Intronic
930811993 2:55552371-55552393 TTTTAAACCCTTGCATTCCATGG + Intronic
933515113 2:83290703-83290725 TTAAAAACCTTTTCTATTCAAGG + Intergenic
933618731 2:84512046-84512068 CAGAAAACACTTTCTTTTCAAGG - Intergenic
935451931 2:103219913-103219935 TTTAAAAACCTTTAAGTTCAGGG + Intergenic
935887792 2:107642590-107642612 TTGTAATCCCTTTTATTTCATGG + Intergenic
936929238 2:117769990-117770012 ATGAAATCCCTTTCTTTCCATGG + Intergenic
938298888 2:130196390-130196412 ATGTGAACCCATTCATTTCAAGG + Intronic
939211038 2:139175131-139175153 TTGAAAACCCCTTCTTGTGATGG - Intergenic
940242245 2:151575891-151575913 TCCAAAACCCTTTCATGTTAGGG + Intronic
941068430 2:160929099-160929121 TTTAAAACCCATTCATTGTATGG - Intergenic
941414603 2:165204553-165204575 TTGAAAACCTTTTCTCTTCCTGG + Intergenic
942269104 2:174256463-174256485 CTCAAAACCCTTCCATATCAAGG + Intergenic
942373775 2:175314584-175314606 TTTAAAACCTTTTAAGTTCAGGG + Intergenic
942415612 2:175756019-175756041 TTCTACACCATTTCATTTCAGGG - Intergenic
943321514 2:186449516-186449538 TTGAGAACCATTTCATTTAGAGG - Intergenic
944560960 2:200937378-200937400 TTCATAGCCCTTTCTTTTCAAGG - Intronic
944759306 2:202797225-202797247 GTGAAAACTTTTACATTTCAAGG - Intronic
946801495 2:223421037-223421059 TTGAGAACTCTTACAATTCAAGG - Intergenic
947799633 2:232920584-232920606 TTTACAACTCTTTGATTTCAGGG - Exonic
1170509251 20:17059881-17059903 ATGAAAACACTTTCATTACTGGG + Intergenic
1174090868 20:48046238-48046260 TTGAAAACTCTTACATGTCAGGG + Intergenic
1174450577 20:50617597-50617619 TTGAAAACCATTTCATTCTAAGG + Intronic
1174847959 20:53962277-53962299 TAAAAAACCCTCTGATTTCATGG + Intronic
1174869773 20:54172239-54172261 TTAAAAACCCTATTAATTCACGG - Intronic
1175355491 20:58363417-58363439 GTGAAAACCCTTTTCTTCCAGGG + Exonic
1177349364 21:19915041-19915063 TTCAAAACCTTTTCATTGCTAGG - Intergenic
1177662281 21:24100684-24100706 TTCAAAACCATGTCATTACATGG - Intergenic
1177663116 21:24113787-24113809 TGGAATACCCTTTCATTTTTGGG - Intergenic
1178797258 21:35756290-35756312 TACAAAACCTTTGCATTTCAGGG - Intronic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
950339521 3:12230271-12230293 TTCAAAGCCCTTGCATTTCCTGG + Intergenic
950588916 3:13921139-13921161 TTGAAAAACTTTCCTTTTCATGG - Intergenic
950777838 3:15365663-15365685 TTGAAAACCATTTCAGCTGAAGG - Intergenic
954543506 3:51412848-51412870 TTGATAACCTATTCATTTGATGG - Intronic
954723773 3:52589790-52589812 TTGAAAAGCATTTCCTCTCAGGG - Intronic
954830169 3:53414547-53414569 TTGAAAATACTTTCAGTTTATGG + Intergenic
955447557 3:59030255-59030277 AAGAAAGCCCTTTCATTTAAGGG + Intronic
955961196 3:64342928-64342950 TAGCAAACTCTTTCTTTTCAGGG + Intronic
956649687 3:71492651-71492673 TGGAGAACCTTATCATTTCAGGG - Intronic
957429207 3:80079889-80079911 TTGAACACCCTTTAATATGAAGG + Intergenic
957910756 3:86618146-86618168 TTCAAAACAGTTTCCTTTCACGG + Intergenic
958597811 3:96252477-96252499 TATAAAAGCCTTCCATTTCAAGG + Intergenic
958740326 3:98061524-98061546 TTAAAAACTCTTTAATTCCATGG + Intergenic
958803441 3:98782047-98782069 TTCAAAACCCTTTCCTCTCAGGG - Intronic
958870035 3:99547575-99547597 TGGAAAACTCCTTCATCTCATGG - Intergenic
959147761 3:102569901-102569923 GGGAATACCCTTTCACTTCAGGG + Intergenic
959154705 3:102652869-102652891 TTGAAAACCCTATAATTAAAGGG + Intergenic
960257480 3:115526408-115526430 TTAAAAACCTTTTAAGTTCAGGG + Intergenic
960421031 3:117445620-117445642 CTGAAAACCCTTGGTTTTCAGGG - Intergenic
963172977 3:142270089-142270111 TGGAAAATGCTTTCCTTTCAAGG + Intergenic
963906556 3:150778516-150778538 TTCAAGACGCTTTCATGTCATGG + Intergenic
965515335 3:169615634-169615656 TAGAAATCCCATTGATTTCAGGG + Intronic
966208678 3:177430492-177430514 TGGAAACCCTTTTTATTTCAAGG + Intergenic
966597037 3:181733354-181733376 ATGAAAACACGTTCATTTCTTGG - Intergenic
967381380 3:188862890-188862912 TTGTCAACCATTTCATGTCATGG + Intronic
967582026 3:191169910-191169932 TTGAAACCACTTCTATTTCATGG + Intergenic
967751971 3:193125494-193125516 TTTAAAAGCCTTTGCTTTCAAGG - Intergenic
967927189 3:194660164-194660186 GTAAAATCCCTTTCACTTCACGG - Intronic
968667730 4:1829908-1829930 TTAAAAACCCTTTGTCTTCAGGG + Intronic
971861737 4:32116103-32116125 TCCAAAAACCTTTAATTTCATGG + Intergenic
972356744 4:38286526-38286548 TTGAAAACTCTGCCATTTCAGGG - Intergenic
972429533 4:38967269-38967291 ATGAAAACCCTTTCTTTTATTGG - Exonic
974546918 4:63323292-63323314 TTGAAAACCCTGTCCTTTCCAGG + Intergenic
974598527 4:64045061-64045083 CTGAAAACCATTACATTTAAAGG - Intergenic
975638547 4:76476220-76476242 TTGAAAACCCTTTGTTTTGAAGG + Intronic
976276425 4:83283662-83283684 ATGGAAACCCTTTGCTTTCAAGG - Intronic
977476943 4:97523448-97523470 TTCAAAACCCTTTCAAGGCAAGG + Intronic
979522558 4:121685681-121685703 TTTAAAAACCTCTCATCTCAAGG - Intronic
980701110 4:136432075-136432097 TTCAAAATACTTTCTTTTCAGGG + Intergenic
980821903 4:138027966-138027988 TGTAAAACCCCTTCATATCAAGG + Intergenic
981314331 4:143326863-143326885 TTGAAAACAGTTTGATTTTATGG - Intergenic
981830198 4:148990664-148990686 TTCAAAACCCTTTCCTTTAGAGG + Intergenic
983042592 4:162947442-162947464 TCGCAAACCCTTTCAATTCACGG - Intergenic
983073975 4:163302491-163302513 TTGAAATCCTTTTAATTTCCTGG - Intergenic
984548495 4:181133731-181133753 TTGAATTCCCTCTCATTTGATGG + Intergenic
985176110 4:187203316-187203338 TTGCAAACCCCTTATTTTCAAGG + Intergenic
985239585 4:187916328-187916350 TGGAAAACCTATTCAATTCATGG - Intergenic
987374544 5:17220845-17220867 TTGAAGCCATTTTCATTTCATGG + Intronic
989122425 5:38017936-38017958 TTTACAAGCCTTTTATTTCAGGG + Intergenic
989247590 5:39271646-39271668 TTGAAAACATTTTTATTTTAAGG - Intronic
989584152 5:43061468-43061490 TTGACAACCATGGCATTTCAGGG + Intergenic
990736614 5:58870770-58870792 TTGAAAACATTTTCATTTGAAGG + Intergenic
990820350 5:59832854-59832876 TAGAAAAAGCTTTAATTTCAAGG + Intronic
991307856 5:65199603-65199625 TTCAGACCCCTTTAATTTCAGGG + Intronic
991432511 5:66562962-66562984 TTGAATATCTTTTGATTTCAAGG + Intergenic
991767111 5:69996932-69996954 TTAAATACCCTTTTATTTAATGG + Intergenic
991846343 5:70872008-70872030 TTAAATACCCTTTTATTTAATGG + Intergenic
992245378 5:74816139-74816161 CTGAAAACCCTTCAATTTCAAGG - Intronic
993802794 5:92364749-92364771 TTGAAAAACCTTTCATTAAAAGG + Intergenic
993968255 5:94385226-94385248 TTCAAAACTATTTCATTTTAAGG - Intronic
994339050 5:98603987-98604009 TTTAAAAAGCTTTCATTTGAGGG + Intergenic
994466576 5:100141758-100141780 TTGAAAACACTATCACTTAAAGG - Intergenic
994685008 5:102939313-102939335 TTCAAAACTCTTTCTTCTCATGG + Intronic
995011787 5:107264463-107264485 TTGATAACTCTTTCATCTCTAGG - Intergenic
995327188 5:110904227-110904249 TTGACATTCCTTTCATTACATGG - Intergenic
995412625 5:111875926-111875948 ATAAAACCCCTTACATTTCACGG - Intronic
995581336 5:113606234-113606256 TGGGACATCCTTTCATTTCAAGG + Intergenic
996131276 5:119784347-119784369 TTGTTAAACCTTTAATTTCATGG - Intergenic
996228028 5:121025645-121025667 TTGAAAACTCTTTGATCTCTTGG - Intergenic
996757588 5:126950813-126950835 TGGAAAAGCCTTCTATTTCAGGG - Intronic
996793726 5:127321221-127321243 ATCAAAATCCTTTCATTTTATGG - Intronic
997741285 5:136257151-136257173 TTTTAAATCCTTTTATTTCATGG - Intronic
1000208848 5:159091619-159091641 TTAACAACCCTTTCAGTTCATGG - Intronic
1000678642 5:164155729-164155751 GTGAAAAGTCTCTCATTTCATGG - Intergenic
1000695825 5:164381799-164381821 TTGAAAACTTTTTAATTACATGG - Intergenic
1000974239 5:167747652-167747674 ATGACATCCCTTTCATTTGAAGG + Intronic
1002028292 5:176410526-176410548 TTGACAACAATTTCATTGCAGGG - Intronic
1004141989 6:13026677-13026699 ATGATAGCCCTTTCATCTCAAGG + Intronic
1004407814 6:15350974-15350996 TTGAAATCTCTTTCAGTACAAGG - Intronic
1004879129 6:19988528-19988550 TTGAAAACCTTTTTTTTTCCTGG - Intergenic
1005440815 6:25865916-25865938 TTCAAAAACCTATGATTTCATGG - Intronic
1007089349 6:39172540-39172562 TGGAAAACCCTTTGTTTGCAGGG + Intergenic
1008200026 6:48574595-48574617 ATGAAAACTGTTTCATTCCAAGG - Intergenic
1008451090 6:51651704-51651726 TTGTGATCACTTTCATTTCAGGG - Intronic
1008646976 6:53524430-53524452 TTGATTATGCTTTCATTTCATGG + Intronic
1008694500 6:54018355-54018377 AGGAAAACACTTTTATTTCATGG + Intronic
1009396799 6:63208311-63208333 TTAAAAACTCTTACATTTAAAGG + Intergenic
1009559848 6:65225390-65225412 TTGAAACTCCTTGCATTTCTGGG - Intronic
1011645286 6:89451848-89451870 TTGAAATTCCTTTAATGTCAGGG + Intronic
1011976057 6:93300114-93300136 TTAAAAAAACTTTCAGTTCAGGG - Intronic
1012513904 6:100036391-100036413 TAGAAAATCCTCTCATTTCCTGG + Intergenic
1013760743 6:113514143-113514165 TTCAAAAACTTTACATTTCAGGG - Intergenic
1014675902 6:124365706-124365728 TTGAAAACCCTTTTGTTTGGTGG - Intronic
1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG + Intronic
1019257518 7:61626-61648 CGGAAAACCCTGTCATTGCAAGG - Intergenic
1020730688 7:11875640-11875662 ATGGAAACCCTTTTATTTAATGG + Intergenic
1021577127 7:22115009-22115031 TTTAAGACCCTTTCAGCTCACGG - Intergenic
1021595463 7:22311889-22311911 TTGAAAGCACTTTTATCTCATGG + Intronic
1022170904 7:27829308-27829330 ATTAAAAACCTATCATTTCATGG - Intronic
1022228396 7:28387791-28387813 TTGAAAACATTTTAAGTTCAGGG - Intronic
1023048538 7:36231907-36231929 TTGGAAACCCTTCCAGTTTATGG - Intronic
1024735456 7:52300026-52300048 TTGAGAAACATTTCATTTCCAGG + Intergenic
1027299898 7:76820978-76821000 TTGTAAACCATTGCATTTCAAGG + Intergenic
1027945516 7:84740171-84740193 TTCAAGACCATTTCATTTAAAGG + Intergenic
1030367996 7:108668439-108668461 TAGCAATACCTTTCATTTCAGGG + Intergenic
1031216983 7:118906976-118906998 TTGTAAACACATTCACTTCAAGG + Intergenic
1031788600 7:126068642-126068664 TTCTAAACACTTTAATTTCAGGG + Intergenic
1032014405 7:128368473-128368495 TTTAAAAACTTTTCATTTCATGG - Intergenic
1034479768 7:151310555-151310577 TTAAAAACCCTTTGAATGCATGG - Intergenic
1035700530 8:1636071-1636093 TTCAAAACCACTTCATTTAAGGG - Intronic
1037253846 8:16928982-16929004 TTGAAAAAACTTTTATTTTAGGG - Intergenic
1040420537 8:47236066-47236088 TTGATACCCACTTCATTTCAGGG - Intergenic
1040585141 8:48733937-48733959 CTTAAAACACTTTCATTTCTGGG - Intronic
1041016608 8:53597835-53597857 TTGAAAACAGTTTCATTTGTGGG - Intergenic
1041085793 8:54255147-54255169 TGGAAATCCATTTCATGTCATGG - Intergenic
1041602658 8:59738511-59738533 TTGGATACCCTTTCTTTTTAAGG - Intergenic
1042153508 8:65815841-65815863 TTAAAAGCCCTTTCATATAATGG - Intronic
1043582334 8:81728337-81728359 ATGTAAACCATTTCATTTAATGG - Intronic
1044747355 8:95383629-95383651 TTGAAATCCCTTTCCTGTCTTGG + Intergenic
1045003902 8:97900957-97900979 CTGAGAACCCTTTTATTCCAAGG + Intronic
1045812141 8:106234161-106234183 TTGAAAATCTTTGCATCTCAGGG - Intergenic
1046309148 8:112412282-112412304 TAGAACACCCTTTTATTTCTAGG + Intronic
1046383084 8:113475233-113475255 TAGAAAACCTTTTAATTTCCCGG - Intergenic
1046563556 8:115869375-115869397 TTGAATTCCCTTCCTTTTCAAGG - Intergenic
1047191275 8:122681185-122681207 CTGTAAACCCTCTCATTTTATGG - Intergenic
1047344425 8:124012988-124013010 TGGGGAACCCTTTAATTTCAGGG + Intronic
1048488346 8:134869125-134869147 GTGAAAAGCCTTCTATTTCATGG + Intergenic
1048744611 8:137599980-137600002 TAGGAAACCCTTTTATTCCATGG + Intergenic
1049264761 8:141661648-141661670 TTGTAAACCCTTCCATGGCACGG - Intergenic
1050168698 9:2793201-2793223 TTAAAAATCCTTTGATTTCTAGG + Intronic
1055659848 9:78491849-78491871 TTAAAAAACCTGTCTTTTCATGG + Intergenic
1055670280 9:78598042-78598064 TTGAAAACTCTCTTATTTCATGG - Intergenic
1055927047 9:81521179-81521201 TTGAAAACCCTGTCATTCACAGG - Intergenic
1058873451 9:109222060-109222082 TTTAAAACTTTTTTATTTCAAGG + Intronic
1059691875 9:116693047-116693069 ATGAACAACCTTTCCTTTCATGG - Intronic
1059709275 9:116852549-116852571 TTGAAATCCCTTTCCCTTGAGGG - Intronic
1059979256 9:119751688-119751710 TTGAAAACCTGTTGATTTCCAGG - Intergenic
1061399082 9:130358630-130358652 TTGCTAACACTTTCATTTCAGGG - Intronic
1186260685 X:7775810-7775832 TTGAAAAGCCTTTTATTCTAAGG + Intergenic
1188213912 X:27454804-27454826 TTGTAAAAACTTTCTTTTCAAGG + Intergenic
1188369040 X:29346522-29346544 ATGTAAACTCTTTCAATTCAGGG - Intronic
1190895757 X:54616391-54616413 TGGAATTGCCTTTCATTTCATGG + Intergenic
1195501652 X:105608582-105608604 TTTAAAACAATTACATTTCATGG - Intronic
1197415642 X:126168557-126168579 TTGAAAACTTATTCATATCATGG + Intergenic
1201915231 Y:19174332-19174354 TTGAAAACTCTTTTCTTTAAGGG - Intergenic
1202299924 Y:23401737-23401759 TTCAAAACCCTTTCATTCTGGGG - Intergenic
1202570886 Y:26268861-26268883 TTCAAAACCCTTTCATTCTGGGG + Intergenic