ID: 1090717896

View in Genome Browser
Species Human (GRCh38)
Location 11:129446428-129446450
Sequence TGTTAGGCCTTTTACTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090717896_1090717899 -9 Left 1090717896 11:129446428-129446450 CCTCTCCAGTAAAAGGCCTAACA 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1090717899 11:129446442-129446464 GGCCTAACACGTACCTTGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1090717896_1090717898 -10 Left 1090717896 11:129446428-129446450 CCTCTCCAGTAAAAGGCCTAACA 0: 1
1: 0
2: 1
3: 9
4: 133
Right 1090717898 11:129446441-129446463 AGGCCTAACACGTACCTTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090717896 Original CRISPR TGTTAGGCCTTTTACTGGAG AGG (reversed) Intronic
905043370 1:34977802-34977824 TGTTGGGGCTTTTTCTGGAAAGG - Intergenic
905356848 1:37390713-37390735 TGTCAGGCCTTGTGCTGGTGAGG - Intergenic
913054494 1:115144927-115144949 GATTTGGGCTTTTACTGGAGGGG + Intergenic
913390382 1:118304227-118304249 TGTTTGGCATTTTACTGATGAGG + Intergenic
919844735 1:201634720-201634742 TGTTAGCCATTTCAGTGGAGTGG + Intronic
921832013 1:219738032-219738054 TTTTCTGCCTTTTACTGAAGAGG + Intronic
922940583 1:229461514-229461536 TGTTAGGCAATTTAGAGGAGAGG - Intronic
1062813460 10:482349-482371 TGGGAGGCCTCTTCCTGGAGAGG + Intronic
1063219159 10:3950379-3950401 TGATAGGCCCTGTACAGGAGGGG + Intergenic
1064399281 10:15007719-15007741 CGTTATGCCTTTAACTGGAATGG - Intergenic
1077604505 11:3599499-3599521 CGTTATGCCTTTCACTGGAATGG - Intergenic
1078832084 11:14987526-14987548 TGTTATGCCTTTAACTGGAATGG - Intronic
1084226963 11:67722314-67722336 TGTTATGCCTTTCACTGGAATGG - Intergenic
1084808236 11:71594541-71594563 CGTTATGCCTTTCACTGGAATGG + Intronic
1084812375 11:71621155-71621177 CGTTATGCCTTTAACTGGAATGG + Intergenic
1084845343 11:71894551-71894573 CGTTATGCCTTTAACTGGAATGG + Intronic
1086352883 11:85960738-85960760 TGTGAGGACTGTGACTGGAGGGG + Intronic
1086444166 11:86856894-86856916 TGTTATGCCTTTAACTGGAATGG - Intronic
1090130877 11:124141062-124141084 TGGTAGGCCTTTTAATGGAGTGG + Intronic
1090159355 11:124475971-124475993 TGTTTGGCTTTTTACTTGTGAGG + Intergenic
1090201745 11:124862642-124862664 TCTTTGTCCTTTTTCTGGAGTGG - Intergenic
1090224298 11:125060606-125060628 TAGTAGGCCTTTTGATGGAGAGG - Intergenic
1090717896 11:129446428-129446450 TGTTAGGCCTTTTACTGGAGAGG - Intronic
1092431657 12:8414635-8414657 CGTTATGCCTTTAACTGGAATGG - Intergenic
1092434609 12:8437258-8437280 CGTTATGCCTTTAACTGGAATGG - Intergenic
1092497240 12:9008996-9009018 AGTGAGGCCTTTTGCTGGATTGG + Exonic
1093492032 12:19716151-19716173 TGTTTGGATTTTTATTGGAGAGG + Intronic
1094579768 12:31723596-31723618 TGATAGGTCTTTTACTGCAAAGG + Intronic
1098447969 12:70587008-70587030 TGTTCTTCCTTTTACTGAAGAGG + Exonic
1098899272 12:76096329-76096351 TCTTATGCCTTTAACTGGAAAGG - Intergenic
1103882365 12:124175894-124175916 TGGCAGGCATTTTTCTGGAGGGG - Intronic
1107546652 13:41439692-41439714 CGTTATGCCTTTAACTGGAATGG - Intergenic
1109839459 13:67903341-67903363 CGTTATGCCTTTAACTGGAATGG + Intergenic
1116939839 14:50780169-50780191 TTTTAGGCAGTTTGCTGGAGAGG - Intronic
1117039663 14:51758108-51758130 CGTTATGCCTTTCACTGGAATGG + Intergenic
1117041275 14:51771649-51771671 CGTTATGCCTTTAACTGGAATGG - Intergenic
1120891927 14:89499074-89499096 TGTGGGGCCTTTTCCTGGACGGG - Intronic
1124929544 15:34105963-34105985 TGTTAGGCATTTTGCAGGTGTGG - Exonic
1125736439 15:41929609-41929631 TTTTAGGCTCTTTGCTGGAGAGG + Intronic
1131592752 15:93767472-93767494 TATTATTCCCTTTACTGGAGGGG + Intergenic
1134167256 16:11940927-11940949 TGTTATCCCAGTTACTGGAGAGG - Intronic
1134493453 16:14712825-14712847 TGTTATCCCAGTTACTGGAGAGG + Intronic
1134498834 16:14751949-14751971 TGTTATCCCAGTTACTGGAGAGG + Intronic
1134525388 16:14938578-14938600 TGTTATCCCAGTTACTGGAGAGG + Intronic
1134547507 16:15122330-15122352 TGTTATCCCAGTTACTGGAGAGG - Intronic
1134581742 16:15377136-15377158 TGTTATCCCAGTTACTGGAGAGG - Intronic
1134712973 16:16337062-16337084 TGTTATCCCAGTTACTGGAGAGG + Intergenic
1134720839 16:16380380-16380402 TGTTATCCCAGTTACTGGAGAGG + Intronic
1134946588 16:18331505-18331527 TGTTATCCCAGTTACTGGAGAGG - Intronic
1134953847 16:18371620-18371642 TGTTATCCCAGTTACTGGAGAGG - Intergenic
1135312680 16:21418567-21418589 TGTTATCCCAGTTACTGGAGAGG - Intronic
1135365597 16:21850837-21850859 TGTTATCCCAGTTACTGGAGAGG - Intronic
1135446211 16:22520315-22520337 TGTTATCCCAGTTACTGGAGAGG + Intronic
1136151822 16:28356293-28356315 TGTTATCCCAGTTACTGGAGAGG - Intronic
1136168056 16:28470131-28470153 TGTTATCCCAGTTACTGGAGAGG - Intronic
1136194916 16:28644875-28644897 TGTTATCCCAGTTACTGGAGAGG + Intronic
1136211257 16:28758990-28759012 TGTTATCCCAGTTACTGGAGAGG + Intronic
1136255979 16:29038940-29038962 TGTTATCCCAGTTACTGGAGAGG + Intronic
1136309353 16:29397326-29397348 TGTTATCCCAGTTACTGGAGAGG - Intronic
1136322800 16:29499082-29499104 TGTTATCCCAGTTACTGGAGAGG - Intronic
1136331108 16:29577355-29577377 TGTTTGGCATTTAACTGGTGGGG - Intergenic
1136437482 16:30239050-30239072 TGTTATCCCAGTTACTGGAGAGG - Intronic
1136445753 16:30317102-30317124 TGTTTGGCATTTAACTGGTGGGG - Intergenic
1145207456 17:20992142-20992164 TGTGTGGCCTTTGACTGAAGTGG - Intergenic
1147048736 17:37774722-37774744 TGGTAGGCCTTTTTCAGTAGAGG - Intergenic
1149570146 17:57666516-57666538 TGTTAGGCCTGATACTGGTAGGG - Intronic
1150263135 17:63813038-63813060 TGTTAGGCCTTCTAGTGTAAGGG - Intronic
1153795631 18:8619294-8619316 GGTTAGGCTTTTTACTGGAAAGG + Intronic
1154118532 18:11633034-11633056 TGTTACCCCAGTTACTGGAGAGG - Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
926197919 2:10774731-10774753 TGCTAGGCCTTGTGCGGGAGTGG - Intronic
926431295 2:12788224-12788246 TGTTAGGCGCTGTAATGGAGTGG + Intergenic
926442437 2:12903910-12903932 TGTTAGGCTTTTTGGTGAAGGGG - Intergenic
927411032 2:22826700-22826722 TCTTAAGCCTTTTTCTAGAGTGG - Intergenic
932232581 2:70094856-70094878 TGTTAGGCCTTGCACTGGTGAGG - Intergenic
932350817 2:71030013-71030035 CGTTATGCCTTTAACTGGAAGGG + Intergenic
932354305 2:71056275-71056297 CGTTATGCCTTTAACTGGAATGG + Intergenic
933246698 2:79984251-79984273 TCTTAGGCATTTTTCTGAAGAGG - Intronic
933939295 2:87232249-87232271 TTCTAGGGCTTTTTCTGGAGTGG + Intergenic
936353838 2:111733529-111733551 TTCTAGGGCTTTTTCTGGAGTGG - Intergenic
940870342 2:158854696-158854718 CGTTATGCCTTTAACTGGAATGG + Intronic
940873050 2:158875790-158875812 CGTTATGCCTTTAACTGGAATGG + Intergenic
1169183844 20:3595036-3595058 TGTCAGGCATCTTCCTGGAGAGG + Intronic
1169651506 20:7873366-7873388 TTTTGGGCCTTTCTCTGGAGGGG - Intergenic
1170878582 20:20274018-20274040 TACTAGGCTTTTTTCTGGAGGGG + Intronic
1174292114 20:49516743-49516765 TATTAGGCCTTTTACTGAAAAGG + Intronic
1177750456 21:25276846-25276868 TAATAGGCAATTTACTGGAGAGG + Intergenic
1183589650 22:38772563-38772585 TGTTAGGCCTGTGACTGTACAGG - Intronic
957043561 3:75356346-75356368 CGTTATGCCTTTAACTGGAATGG - Intergenic
959465694 3:106683853-106683875 CATTAAGCCATTTACTGGAGGGG + Intergenic
961273090 3:125704460-125704482 CGTTATGCCTTTAACTGGAATGG + Intergenic
961275834 3:125725628-125725650 CGTTATGCCTTTAACTGGAATGG + Intergenic
961278751 3:125748223-125748245 CGTTATGCCTTTAACTGGAATGG + Intergenic
961875647 3:130021411-130021433 CGTTATGCCTTTAACTGGAATGG - Intergenic
962021307 3:131504656-131504678 TGTTAGTCATTTTGCTGCAGTGG + Intergenic
965289212 3:166855825-166855847 TCTTAGTCATTATACTGGAGGGG - Intergenic
966745539 3:183272349-183272371 TCTAAGGCCTTTGACTGCAGAGG + Exonic
968259452 3:197308112-197308134 TTTTAGGCCAATTACTGCAGTGG - Intergenic
968675555 4:1876839-1876861 TGTTATGCCGTTTGCTGGTGCGG + Intronic
968988001 4:3889158-3889180 CGTTATGCCTTTCACTGGAATGG - Intergenic
969023635 4:4156334-4156356 CGTTATGCCTTTTACTGGAATGG - Intergenic
969085389 4:4652472-4652494 TCTGGGGCCTTTTCCTGGAGGGG - Intergenic
969735041 4:8982536-8982558 CGTTATGCCTTTCACTGGAATGG + Intergenic
969789777 4:9484850-9484872 CGTTATGCCTTTCACTGGAATGG + Intergenic
969794257 4:9514015-9514037 CGTTATGCCTTTCACTGGAATGG + Intergenic
974072544 4:57137660-57137682 TATTAAGGCTTTTACTGGAATGG - Intergenic
977805264 4:101290320-101290342 TGTTGGGCCATTAACAGGAGCGG - Intronic
982556971 4:156879454-156879476 TGTTAGGCTTCTTACTAAAGAGG - Intronic
987999811 5:25333523-25333545 TGAAAGCCCTTTGACTGGAGTGG - Intergenic
990910686 5:60849375-60849397 TGGCTGGCCTTGTACTGGAGGGG - Intergenic
991476602 5:67027945-67027967 TGTTAGGGATTGTGCTGGAGAGG + Intronic
992817389 5:80457551-80457573 TGTTAGGCCTTCTACTGCAAGGG - Intronic
993735313 5:91469352-91469374 TCTTGGGCCTTTTATTGTAGGGG + Intergenic
997699150 5:135884305-135884327 TGTGAAACCTGTTACTGGAGCGG + Intronic
1008194732 6:48504585-48504607 TGTTATTCCTTTTTCTTGAGTGG - Intergenic
1013417919 6:109940969-109940991 AATTTGGCCTTTTACTGGGGAGG + Intergenic
1016507885 6:144804842-144804864 TCTTAGGGCATTTACTGGAAAGG - Intronic
1018058561 6:160072176-160072198 TGTTTGGCCTTTCTCTGGATGGG + Intronic
1020310743 7:6866511-6866533 CGTTATGCCTTTCACTGGAATGG - Intergenic
1022099721 7:27161830-27161852 TGTTAGGCCTTGTGCTCGAGAGG + Intergenic
1022147166 7:27556258-27556280 TGATAGGCAGTTTACTGAAGAGG - Intronic
1029077454 7:97946838-97946860 CGTTATGCCTTTAACTGGAATGG - Intergenic
1031210653 7:118822286-118822308 TGTCAGTCCCTTTACTAGAGAGG + Intergenic
1036641091 8:10584362-10584384 TGCTAGGCTTGTTACTGGAAAGG - Intergenic
1036832614 8:12033472-12033494 CGTTATGCCTTTAACTGGAATGG - Intergenic
1038043242 8:23744574-23744596 TGTTAGGTCTTTTGCTGGTTAGG + Intergenic
1045232766 8:100320577-100320599 TTTTAGACCTTGTACTGGAAGGG - Intronic
1045865856 8:106864571-106864593 TGAGATGCCTTTTGCTGGAGCGG + Intergenic
1046171438 8:110512826-110512848 TATTAGAAATTTTACTGGAGGGG - Intergenic
1048410778 8:134170187-134170209 TACTAGGCCTTGTAATGGAGGGG - Intergenic
1052722934 9:32194199-32194221 TTTTTGGCCATTTACTGCAGAGG - Intergenic
1053034912 9:34816879-34816901 AGTTTTGCCTTTGACTGGAGTGG - Intergenic
1056866679 9:90233238-90233260 CGTTATGCCTTTAACTGGAATGG + Intergenic
1056916480 9:90751079-90751101 CGTTGTGCCTTTAACTGGAGTGG - Intergenic
1059324786 9:113497603-113497625 TGGTTGGACTTTTACTGTAGAGG + Intronic
1059492221 9:114677640-114677662 TGTCTGGAGTTTTACTGGAGTGG + Intergenic
1061914410 9:133741885-133741907 TGTTAGGCCATGGAGTGGAGAGG - Intergenic
1186942404 X:14524630-14524652 TGTCAGGACTTTTACTGAACGGG - Intergenic
1187534378 X:20125197-20125219 TGTGAGGCAGTGTACTGGAGAGG - Exonic
1190937400 X:55009032-55009054 TGTGAAGCCTTTTATTGGACAGG - Exonic
1195150115 X:102059071-102059093 TGTTATGCCCTTTCCTGCAGTGG + Intergenic
1196025215 X:111034673-111034695 TGTTAGGACTTGTAGTGTAGGGG + Intronic
1196127549 X:112115428-112115450 TGTTAGGCCTCAAAATGGAGGGG + Intergenic
1201722602 Y:17117302-17117324 TATAAAGCCTTTTACTTGAGGGG - Intergenic