ID: 1090718205

View in Genome Browser
Species Human (GRCh38)
Location 11:129449269-129449291
Sequence CTGCTGCTCTTGAAGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 6, 3: 27, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090718200_1090718205 4 Left 1090718200 11:129449242-129449264 CCTTAAAATTCAGCACCTGGAGG 0: 1
1: 0
2: 5
3: 14
4: 150
Right 1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG 0: 1
1: 0
2: 6
3: 27
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090718205 Original CRISPR CTGCTGCTCTTGAAGGAAAG AGG Intronic
901956342 1:12788329-12788351 CTGCTGCTCTGGACCTAAAGAGG - Intergenic
901959206 1:12810957-12810979 CTGCTGCTCTGGACCTAAAGAGG - Intergenic
901979723 1:13024384-13024406 CTGCTGCTCTGGACCTAAAGAGG - Intronic
901987444 1:13087099-13087121 CTGCTGCCCCTAAAGGAAGGGGG - Intergenic
901994368 1:13139668-13139690 CTGCTGCCCCTAAAGGAAGGGGG + Intergenic
902002360 1:13204554-13204576 CTGCTGCTCTGGACCTAAAGAGG + Intergenic
902021589 1:13350318-13350340 CTGCTGCTCTGGACCTAAAGAGG + Intergenic
903686170 1:25133838-25133860 CCAGTGCTCTTGAAGGTAAGAGG - Intergenic
903809911 1:26029499-26029521 CTGCTGCTGTTGGGGGCAAGGGG - Intronic
903845348 1:26276665-26276687 CTGCAGATCTTGAAGGCAACTGG - Exonic
904500758 1:30911548-30911570 CTGCTGCTCTTCAAAGACACTGG + Intergenic
905024572 1:34840852-34840874 CTGCTCCCCTTGGAGGAATGGGG - Intronic
905278435 1:36833882-36833904 CTGCTGCTGGTGAAGGCAACAGG + Intronic
905872743 1:41414537-41414559 CTGGTGCCCCTGAAGGAAGGAGG + Intergenic
906536560 1:46554075-46554097 CTCCTGGTCCTGAGGGAAAGAGG - Intergenic
909288622 1:73853942-73853964 CTGATACTTTTGAAGGAGAGAGG - Intergenic
909993196 1:82248524-82248546 GGGCTTCACTTGAAGGAAAGTGG - Intergenic
910489210 1:87749646-87749668 CTGCTGGTCTTGTAGGGAAATGG - Intergenic
910536783 1:88307189-88307211 CTGCTCTTCTTGAAGTCAAGAGG + Intergenic
910951565 1:92653702-92653724 CTGCTGCTCTGCATGGAGAGGGG - Intronic
912557951 1:110529836-110529858 CTGCTGTTCTCGAGGTAAAGAGG + Intergenic
912795960 1:112693851-112693873 CTGCTGGTATGAAAGGAAAGAGG + Intronic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915046769 1:153023999-153024021 CTGCTGCTGTTGAAGCTGAGGGG - Intergenic
917016644 1:170539321-170539343 CAGCTGCTCTGGAAGTAATGAGG - Exonic
917170233 1:172164775-172164797 CTCCTGCTCCTGGAGGACAGAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918314318 1:183310423-183310445 CTCAGGCTCATGAAGGAAAGAGG - Intronic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920099111 1:203505827-203505849 CTGCTGCTCTGAAAGTCAAGGGG - Intronic
920521268 1:206628831-206628853 CTGGGAATCTTGAAGGAAAGAGG + Intergenic
920650197 1:207831847-207831869 CTGCTGCTCTTGTGGGCAGGAGG + Intergenic
922675267 1:227545588-227545610 GAGCTGCTCTTGAAGCCAAGAGG + Intergenic
923363225 1:233233703-233233725 GTGCTGCACTTGAAGGAGAGAGG + Intronic
923766146 1:236893908-236893930 CTGCTGCTGTTGATGGAGAGTGG + Intronic
924373133 1:243376167-243376189 TTGCTGTTCTTGAAAGACAGAGG + Intronic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1064229469 10:13517356-13517378 CTGCTGCACATGGAGGCAAGAGG + Intronic
1064523803 10:16231787-16231809 CTTCCGCTCTTGTAGGAATGTGG - Intergenic
1068141429 10:53013077-53013099 CTGCAGCGCTTGAAGGAACATGG - Intergenic
1068977217 10:63022906-63022928 CTCCTTCTCTTACAGGAAAGGGG - Intergenic
1070187835 10:74083523-74083545 CTACTGCTCTGTAAGGACAGAGG - Intronic
1070639640 10:78158450-78158472 CATCTGCTCTTGAAGCAAGGGGG + Intergenic
1072019778 10:91386918-91386940 AAGCTGCTCTTGAGGTAAAGTGG - Intergenic
1072578575 10:96720911-96720933 CTGCTGCCCCAGCAGGAAAGGGG + Intergenic
1072971384 10:100020785-100020807 CTGCATCTCTTGAACGTAAGGGG - Intergenic
1076507334 10:130986879-130986901 CTGCTGCTCTTGGAGGACCCCGG - Intergenic
1076874852 10:133210984-133211006 CTGCTGACCTGGGAGGAAAGCGG + Intronic
1077673769 11:4180363-4180385 TAGCTGCTCTTCTAGGAAAGTGG + Intergenic
1077757754 11:5053489-5053511 ATGCTGCTCTTAAAGATAAGTGG - Intergenic
1077970721 11:7187207-7187229 CTGCTGCTCTAGAAAGTAAGAGG + Intergenic
1078089396 11:8255078-8255100 ATTCTGCTCTTGAAGGTAGGAGG - Intronic
1078286012 11:9956908-9956930 CCTCTGCTCTTGAAGGATATGGG - Intronic
1078454128 11:11461997-11462019 CTTCTGGTCTTAAAGGGAAGCGG + Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079627569 11:22634400-22634422 CTGGTGCTCATGAAGGAACCTGG - Intronic
1079716901 11:23758555-23758577 TGGCTGCTTTTGAAGGACAGTGG + Intergenic
1079948912 11:26777532-26777554 CTGCTGCTGTTGCAAGAAATAGG + Intergenic
1082115311 11:48321699-48321721 ATGCTACTCTTGGAGGAAACTGG + Intergenic
1082258364 11:50057587-50057609 ATGCTACTCTTGGAGGAAACTGG - Intergenic
1083096133 11:60253519-60253541 CTGATTCTCTTCAGGGAAAGAGG + Intergenic
1083226093 11:61285732-61285754 CTGCTGCTGTTGCAGGATAAAGG - Intronic
1083799104 11:65036028-65036050 CTGCAGATCCTGAAGGCAAGAGG + Intronic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089726535 11:120485529-120485551 CAACTGCTCCTGAAGCAAAGAGG + Exonic
1090068002 11:123519667-123519689 CTCCTGCTCCTGGAGCAAAGAGG + Intergenic
1090663031 11:128895276-128895298 CTGCTGCTCAGAAAGGAAAATGG + Intronic
1090701281 11:129297985-129298007 CTCCTGCTGTGGCAGGAAAGAGG + Intergenic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1092649050 12:10613327-10613349 CTGCTTCCCTCGAAGGAAATAGG - Intronic
1092940979 12:13406719-13406741 CAGCTGGTCTTGAAAGCAAGTGG - Intergenic
1093294992 12:17378985-17379007 CTGCTGTTCTTGTAAGAAAGAGG + Intergenic
1095969573 12:47892349-47892371 CTGCTGCCCTTGAAAGTGAGTGG - Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1099776360 12:87136737-87136759 CTTCCACTCCTGAAGGAAAGTGG + Intergenic
1101236578 12:102795876-102795898 CTGGTGCCCTTGCAGGGAAGAGG + Intergenic
1101748751 12:107565240-107565262 CTGCAGGACTTGAAGGAAATGGG + Intronic
1101846644 12:108368270-108368292 GGGCTGCTTTGGAAGGAAAGAGG - Intergenic
1102406701 12:112679880-112679902 CTGAGTGTCTTGAAGGAAAGAGG + Intronic
1103393635 12:120591609-120591631 CTACTGCTCTTGTAAGAATGGGG + Intergenic
1103412786 12:120724787-120724809 CTCTTCCTCTTGGAGGAAAGTGG - Intergenic
1104996539 12:132661312-132661334 CTGCTTCTCTAAAAGGAAAATGG + Intronic
1106546924 13:30738810-30738832 CTGCCTCTCTTGGGGGAAAGAGG - Intronic
1107142082 13:37010564-37010586 CTGCTGCTGTTGAAAGGCAGAGG + Intronic
1109269855 13:60242932-60242954 TTGCTTCCCATGAAGGAAAGAGG + Intergenic
1110213636 13:73002510-73002532 ATACTGCTCAGGAAGGAAAGAGG - Intronic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110582135 13:77142997-77143019 CTGATGCTCCTCAAGGAAAGGGG - Intronic
1111447467 13:88366673-88366695 CTGTTGCTCTTGAAAGATATTGG + Intergenic
1111681629 13:91448908-91448930 CGGCTGCTTTTCAAGGTAAGTGG + Exonic
1111813233 13:93118627-93118649 TTGCTGCTTTTGAAAGAAAAGGG + Intergenic
1112729806 13:102348296-102348318 CTGCTGATCTTTTAGGAAACTGG - Intronic
1113217100 13:108054920-108054942 AAGCTACTCTTGAAAGAAAGTGG - Intergenic
1113744429 13:112733257-112733279 CTGCTCATCTTTAAGTAAAGTGG - Intronic
1113866266 13:113527549-113527571 GTGCTTCTCTCGAAGGAATGAGG + Intronic
1115335981 14:32244688-32244710 CTGCCTGTCTGGAAGGAAAGGGG - Intergenic
1117200265 14:53382924-53382946 CTGCAGCTCTGGAAGGGCAGAGG + Intergenic
1118005492 14:61561489-61561511 CTGCTGCTTTTGAAGTGCAGTGG - Intronic
1118516934 14:66540404-66540426 ATGCTCCTTTTGAAGGAAAGTGG + Intronic
1119642718 14:76327101-76327123 CTGCTGGTAGTGAAGGACAGTGG - Intronic
1120211016 14:81633903-81633925 CTGCTCCTCTTAAAGGAGATTGG - Intergenic
1120340091 14:83208447-83208469 CTGCTGCTCTGAAATGAAAGAGG - Intergenic
1121433688 14:93905134-93905156 CTGCTGCTCTGGGAGGCTAGAGG - Intergenic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1121833601 14:97072615-97072637 CTGCTGATCTGGAAAGAAAATGG - Intergenic
1121944418 14:98105266-98105288 CTGCTGCCCTTGAAGGGTGGTGG - Intergenic
1122701764 14:103594358-103594380 ATGCTGCTCTTTAAAGGAAGCGG + Intronic
1124399322 15:29334650-29334672 CTTCTCCTCCTGAAGGAAAGTGG + Intronic
1125631966 15:41154541-41154563 CTGCTGCCCTGAAAGGAAACTGG - Intergenic
1126687813 15:51263743-51263765 CTGCTGCTCTGGGAATAAAGGGG + Intronic
1126913382 15:53438232-53438254 CTGCTGCCCAGGAAGAAAAGGGG + Intergenic
1128036743 15:64533789-64533811 ATGCTGCTATTGGAGGAAATTGG - Intronic
1128146885 15:65336904-65336926 TTCCTGCACTTGAAGCAAAGTGG - Intronic
1129582999 15:76831765-76831787 CTGCTGCACTTGAGGGACCGAGG - Intronic
1133868806 16:9668903-9668925 CTCCTGCTCTTGGAGGGAAATGG + Intronic
1135158795 16:20075244-20075266 TTGCTGGTCTTGAGGGACAGGGG - Intergenic
1135482977 16:22838425-22838447 CTGCGGCTGCTGGAGGAAAGAGG - Intronic
1137549118 16:49424705-49424727 CTGGGGTTCTGGAAGGAAAGGGG + Intergenic
1137572188 16:49574022-49574044 CAGGTGATCTTTAAGGAAAGTGG + Intronic
1137757262 16:50912567-50912589 TGGCTGCTCTTGAAGGAGGGAGG - Intergenic
1138933754 16:61694259-61694281 GTGCTTTTCTAGAAGGAAAGTGG + Intronic
1139084831 16:63572169-63572191 ATGCTGCTTTTGAAAGAAAATGG + Intergenic
1140450759 16:75069057-75069079 CTGCTGCTCTTTAGCCAAAGGGG + Intronic
1141218482 16:82046955-82046977 GTGCTCCCCTTGAGGGAAAGGGG + Intronic
1141331219 16:83113065-83113087 CTGATGCTATCGAAGGAAAAAGG + Intronic
1141486883 16:84346262-84346284 CTGCTGCTCTAGAGAGAAACAGG + Intergenic
1141607174 16:85160709-85160731 CAGCTGCTCTGGAAGGCAGGGGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1142817300 17:2436494-2436516 CTCCTGCTCTTGTAGGGTAGAGG - Intronic
1144732579 17:17537181-17537203 CTGCTGCCCTGGAAAGAAGGAGG + Intronic
1145322994 17:21777440-21777462 CTGGGGCTCTTGCAGGATAGGGG + Intergenic
1146964485 17:37013470-37013492 CTTCTGTTCATGAAGGAAGGCGG + Intronic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1150508508 17:65724040-65724062 CTGCTTCTCTTGAAAAAATGGGG + Intronic
1150836294 17:68567218-68567240 CTGCTGTTATTGCACGAAAGGGG + Intronic
1151375742 17:73687665-73687687 CTGCAGGTCTTGATGGAGAGAGG - Intergenic
1152528533 17:80903345-80903367 CTACTGCCTTTGGAGGAAAGAGG + Intronic
1153287367 18:3468971-3468993 CTGCTGCTGTTGTAAGAAACTGG - Intergenic
1153471692 18:5453379-5453401 CTGCTGCTCAGGAAGGAATGGGG + Intronic
1154285472 18:13052068-13052090 CTGCACCTCTTGAGGGGAAGCGG - Intronic
1154977701 18:21475264-21475286 CTACTGCTTTTAAAGGCAAGAGG - Intronic
1155848692 18:30743273-30743295 CTTCTTCTCATGGAGGAAAGTGG + Intergenic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1158422426 18:57307082-57307104 CTGGTCCTCATGAAGGAAAAGGG + Intergenic
1158422453 18:57307228-57307250 ATGGTCCTCATGAAGGAAAGGGG - Intergenic
1160139003 18:76302524-76302546 CTGTTGCACCAGAAGGAAAGGGG + Intergenic
1163369921 19:16896319-16896341 CCGCTGCTCTGGAAGGAAGGGGG + Exonic
1163920432 19:20283707-20283729 CAGCTGCTCCTGCAGGAATGGGG - Intergenic
1164755882 19:30689114-30689136 CTGAGGCTTTGGAAGGAAAGAGG + Intronic
1165410885 19:35660574-35660596 TAGCTGCTCATGAAGAAAAGTGG + Intergenic
1165462711 19:35953478-35953500 ATGAAGCTATTGAAGGAAAGTGG + Intergenic
925912551 2:8583119-8583141 TTGCTGTCCTGGAAGGAAAGGGG - Intergenic
926017179 2:9463838-9463860 CTGCTGCTGTAGCAGGAAAGAGG - Intronic
926647153 2:15302360-15302382 CAGCTGCTCCAGATGGAAAGAGG - Intronic
927779833 2:25930055-25930077 CTGCTACTGCTGTAGGAAAGAGG + Exonic
928645418 2:33347216-33347238 CTTCTGCTCTTTTAGGGAAGGGG - Intronic
929088835 2:38194771-38194793 CTCCTCCTCATGAAGGAAAATGG - Intergenic
929450671 2:42034964-42034986 AAGCTGCCCTTGAGGGAAAGTGG + Intergenic
932238236 2:70138276-70138298 CTGCTCCTGTTGCAGGAAAGAGG - Intergenic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
933010764 2:77059864-77059886 CTGCTGCTCTTGAGAGAAGTTGG - Intronic
935936134 2:108185101-108185123 CTGCTGTCCATGAAGGAAGGAGG - Intergenic
937624026 2:124024200-124024222 TTGCTTCTGTTGAAGGTAAGAGG + Intergenic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
941196625 2:162460255-162460277 CTTCTTCTCTCGAAGGAAGGAGG - Intronic
943359800 2:186904100-186904122 CTGTTGCTATTTAAGAAAAGAGG + Intergenic
943407085 2:187502648-187502670 GTGCTGCTGTTGATGGGAAGAGG - Intronic
944641149 2:201727358-201727380 CTGTTCCTCTTGAAATAAAGAGG - Intronic
946727244 2:222672587-222672609 GTTCTGCTCTTGAAGTAAATAGG + Intronic
947989064 2:234472866-234472888 CTGCTCTTCTTGTAGGACAGAGG + Intergenic
949062306 2:241968548-241968570 CTGCTGCTCCTGCAGGAACCTGG - Intergenic
1169135539 20:3195008-3195030 CTGCTGCTTGTGTAGGCAAGCGG - Intronic
1171090449 20:22280607-22280629 CTGCTGTTGTTGTGGGAAAGTGG - Intergenic
1173227044 20:41168174-41168196 CTGCTGCCCAGGAAGGAAACAGG - Intronic
1173909210 20:46651539-46651561 CTGCTCCTCCTGGAGGAAAAGGG + Intronic
1173947173 20:46960858-46960880 CTGCTGCTCCAGCAGGGAAGGGG - Intronic
1174115081 20:48221268-48221290 CTGCTTCTCCTGAAAGGAAGGGG - Intergenic
1175273335 20:57750091-57750113 CTTCTGCTGTTACAGGAAAGCGG - Intergenic
1175467267 20:59197803-59197825 GTGCTGCTCTTGGAGGAAAGGGG + Intronic
1175770263 20:61619013-61619035 TTGCTGCTCTGGAAAGGAAGAGG - Intronic
1175957225 20:62617588-62617610 CTGCTGCCCATGAGGGAAGGAGG - Intergenic
1178191670 21:30289246-30289268 CTGCTGTGCATGAAGGAAATAGG + Exonic
1182825179 22:33258803-33258825 CTCCTGCTGTTACAGGAAAGGGG - Intronic
1184075736 22:42176361-42176383 CTGCTGCGCTGGAAGGAAGGGGG + Intronic
1184861410 22:47175034-47175056 CGGCTGCTCCTGAGGGACAGAGG - Exonic
1184915661 22:47567302-47567324 CTGGTGCGCTAGAAGGAGAGGGG - Intergenic
1185179869 22:49353082-49353104 GTGCTTCTCTTGGAGGACAGAGG + Intergenic
950067705 3:10126377-10126399 CTGTTGCTCTTTAAGGAGAAAGG - Exonic
950642224 3:14355779-14355801 CTTCTGCCCTTGAAAGAAAGTGG + Intergenic
950973249 3:17211334-17211356 CTGGTGCTCTGGAAAGCAAGTGG + Intronic
951620364 3:24594748-24594770 CTTCTGCACCTGAAGGACAGAGG - Intergenic
951825496 3:26863856-26863878 CTGCTCCTCTTCCTGGAAAGAGG - Intergenic
952902910 3:38121518-38121540 CTGATGCTCCTGAAGAAAACGGG - Intronic
954114806 3:48460565-48460587 CTGCTGCTGGGGAAGGAAACAGG + Exonic
954482770 3:50816877-50816899 CTGCAGCTGTTACAGGAAAGGGG + Intronic
954692625 3:52403739-52403761 CTGCTAGTCTTGATGGACAGAGG + Exonic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
955544896 3:60017935-60017957 CTGCAACTCTTGATGGAAAGTGG - Intronic
955779822 3:62472600-62472622 CAGCTGCTCTGGATGGAGAGGGG - Intronic
956119004 3:65947157-65947179 CTGTAGTTCTTCAAGGAAAGAGG + Intronic
956273984 3:67477796-67477818 CTGCTGCTCTTTGAGGAATGGGG - Intronic
956748647 3:72329347-72329369 CCGTTGCTCCTGAAGGGAAGGGG + Intergenic
956786095 3:72643650-72643672 CTGCCCCTCAGGAAGGAAAGAGG + Intergenic
958668630 3:97173628-97173650 CTGCTTCTCTTTTAGGTAAGTGG + Intronic
960162105 3:114361732-114361754 CTTCTGCATTTGAGGGAAAGTGG - Intronic
961175216 3:124829859-124829881 CTGCTGGTCTTAAAAGAGAGAGG - Intronic
961981319 3:131082052-131082074 CTGCTTTGCTTGGAGGAAAGTGG + Intronic
962068242 3:132006156-132006178 CTCCTTCTATTTAAGGAAAGTGG + Intronic
962752056 3:138440780-138440802 CTGTTGGGCTTGGAGGAAAGAGG - Intronic
963384304 3:144571273-144571295 ATGCTTGACTTGAAGGAAAGAGG + Intergenic
963605409 3:147408795-147408817 TTGCTGCTCTTGAAGGGAGGGGG + Intronic
967102439 3:186226913-186226935 CTAATGCTCTTCAATGAAAGAGG - Intronic
967331105 3:188290596-188290618 CTGATGCTCTTGGAGTGAAGAGG - Intronic
968592542 4:1466174-1466196 CTGCTGCACTTGGAGCAAACTGG - Intergenic
969566602 4:7982323-7982345 TTGAGGCTCCTGAAGGAAAGGGG - Intronic
970110345 4:12630655-12630677 CTGCTGCATATGAAGGCAAGAGG - Intergenic
971924304 4:32987036-32987058 CTGATGAGATTGAAGGAAAGAGG - Intergenic
973605361 4:52581684-52581706 CTGCACTTCTTGAAGGACAGAGG - Intergenic
974344903 4:60666879-60666901 AAGCTGCTATAGAAGGAAAGGGG - Intergenic
975472073 4:74781443-74781465 CTGGTGCTCTTGAAAGACAAGGG - Intronic
976855456 4:89599707-89599729 CTGGTGCACTAGAAGCAAAGAGG - Intergenic
979200435 4:117971431-117971453 CTGCTGCTGTTTAAGGTAAAGGG - Intergenic
979489462 4:121308631-121308653 GTGCTGCCTCTGAAGGAAAGTGG - Intergenic
983368918 4:166833967-166833989 CTTCAGCTTTTGAAGGAAACTGG + Intronic
983396858 4:167209553-167209575 CAGGAGCTCTTTAAGGAAAGTGG - Intronic
984278161 4:177635069-177635091 CTGCTGCTATTGATATAAAGAGG - Intergenic
986521962 5:8628922-8628944 CTGCTGACCCTGAAGGCAAGGGG + Intergenic
987633941 5:20514284-20514306 CTGCAGCTCCTGGAGGTAAGCGG + Intronic
989403894 5:41039135-41039157 CTGCTTTCCCTGAAGGAAAGGGG - Intronic
989618132 5:43357664-43357686 CTGATGTTCCTGAAAGAAAGGGG + Intergenic
990499778 5:56384381-56384403 CAGCTGCTTTTGCTGGAAAGCGG + Intergenic
990662797 5:58037122-58037144 GTGCTGCTCTAGAAGAAAATAGG + Intergenic
991002112 5:61792847-61792869 CTGCAGCTCATGAAGGAAGATGG - Intergenic
993134868 5:83947292-83947314 CTGCTGTTCTTAAGGGATAGAGG + Intronic
993765795 5:91856767-91856789 CTGCTGTGCTTGCAGGAAGGGGG + Intergenic
993856184 5:93078637-93078659 CTGGTGCTGCTGAAGGACAGAGG - Intergenic
996855533 5:128001974-128001996 CTGCTTCTCTTTAAGAAACGAGG + Intergenic
998606745 5:143643116-143643138 CTGGAGCTGTTTAAGGAAAGAGG - Intergenic
998958228 5:147458614-147458636 CTGCTGCTATTACCGGAAAGGGG - Intronic
999145825 5:149393082-149393104 TTGCTGCTGAGGAAGGAAAGGGG - Intronic
1002433752 5:179219203-179219225 CTGCTGCTCCTGGGGGAAGGAGG - Intronic
1005988395 6:30888760-30888782 CTGCTGCTCTTGGTGGCAAGTGG + Exonic
1006452107 6:34111257-34111279 CTGCTGCTCTTGAATGTGTGTGG - Intronic
1006909955 6:37557387-37557409 CGGGTGCTCCTGAGGGAAAGGGG - Intergenic
1007784052 6:44270402-44270424 CGGCTGCGCTGGCAGGAAAGGGG + Intergenic
1008925151 6:56884616-56884638 CTACTGCTGTTGAAGGAAGAAGG - Intronic
1010121355 6:72379351-72379373 CCTCTGCTCTTGAAGGCATGGGG - Intronic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1011617676 6:89211991-89212013 CTGCAGCTCAAGAAGGAAACTGG - Intronic
1011823861 6:91283586-91283608 CTGTTGAGTTTGAAGGAAAGAGG + Intergenic
1013462802 6:110391662-110391684 GTGCTGGTATTGAAGTAAAGAGG - Intergenic
1013524186 6:110959155-110959177 CTGCTCCTGGTGAAAGAAAGAGG - Exonic
1013733438 6:113198406-113198428 CTGCGGTTCAGGAAGGAAAGAGG - Intergenic
1015785693 6:136920832-136920854 CTGCTGGTGGTGAACGAAAGGGG + Intergenic
1016237697 6:141887857-141887879 CTGCTGCACTGGAGGGAATGAGG - Intergenic
1016649556 6:146448294-146448316 CTGCTGCTTTTTAAGGAGAATGG + Intergenic
1017260064 6:152375525-152375547 GTGCTGCTATTGAATGAAGGTGG + Intronic
1017291367 6:152742489-152742511 CTATTGCTCTTGAAGGAAACAGG - Intergenic
1017536909 6:155356920-155356942 ATGATGCTCTTCATGGAAAGAGG + Intergenic
1018333875 6:162763292-162763314 CTGCTGCTTCTCAAGGAGAGAGG - Intronic
1018411262 6:163550964-163550986 CTGCTTCTGTTGGAGGACAGGGG + Intronic
1018657708 6:166055313-166055335 GTGCTTCTCTTTAAGGCAAGTGG + Intergenic
1018788138 6:167124357-167124379 CTTCTGCTTTTGAATGAGAGTGG - Intronic
1019069038 6:169326250-169326272 CTGCTCCTTCTGGAGGAAAGAGG - Intergenic
1019084162 6:169458385-169458407 TTGCTTCTCCTGGAGGAAAGGGG - Intronic
1019376705 7:696695-696717 CCGCTTCTCTTCAAGGAACGAGG + Intronic
1022477960 7:30723962-30723984 GAGCAGCTCTTGAAGGGAAGAGG - Intronic
1023390012 7:39700657-39700679 CTTCAGCTCTTGATGAAAAGTGG + Intronic
1025603882 7:63024904-63024926 GTGTTGCGCTGGAAGGAAAGAGG - Intergenic
1028935555 7:96459863-96459885 ATGATGCTTTTGAAGGAGAGGGG + Intergenic
1029687607 7:102159550-102159572 CTGTTGCTCTGAAAAGAAAGTGG + Intronic
1030554500 7:111006577-111006599 TTGTTGCTCTTGAAAGAAATAGG - Intronic
1033315913 7:140297399-140297421 CTTGTGGTCTTAAAGGAAAGGGG - Intronic
1033710323 7:143936029-143936051 CAGCTTCTCTTGAAGGACTGAGG - Exonic
1035235211 7:157493382-157493404 CTACTGATGATGAAGGAAAGAGG + Intergenic
1035644744 8:1210431-1210453 CTGCTGCTCTTGAATGAACATGG - Intergenic
1037352616 8:17977616-17977638 CTGCTACTCTTGGGGGTAAGGGG - Intronic
1037406728 8:18550273-18550295 CAGCTGCTTTTGAAGAGAAGCGG - Intronic
1037444139 8:18947515-18947537 CTGCTGCTCCTCCAGGCAAGGGG + Intronic
1037916058 8:22774129-22774151 ATGCTGCTCCTGAAGGAAGGAGG + Intronic
1038841074 8:31185460-31185482 ATGGTGCTCTTGAACCAAAGAGG - Intergenic
1040610403 8:48977400-48977422 CTGCTGCTCCTGGAGGCAGGCGG + Intergenic
1041290970 8:56308165-56308187 CTAATGCTTTTGAAGCAAAGTGG - Intronic
1042166621 8:65951776-65951798 ATGCTGCACCGGAAGGAAAGGGG - Intergenic
1042182700 8:66107832-66107854 CTGCTACTCTGGGAGGAAGGAGG - Intergenic
1043556256 8:81433666-81433688 CTGCTGTTCTTGCAGGAGTGAGG + Intergenic
1043704582 8:83332097-83332119 CTGGTCATCTTCAAGGAAAGTGG + Intergenic
1044598194 8:93978718-93978740 CTGCTGCTCTTTCAGGAAGTGGG + Intergenic
1045222356 8:100211545-100211567 CAGCTGCTCTGGAAGCTAAGGGG + Intronic
1045368495 8:101497933-101497955 CTGCTGCTTCTGGAAGAAAGGGG + Intronic
1045707097 8:104937073-104937095 CTGCTGCTCTTGTAGGACACAGG - Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047388258 8:124429446-124429468 CTGCTGCACTTGGAGGAAATAGG - Intergenic
1047766807 8:127996730-127996752 CTGCTGCTGTGGGAGGAAACGGG + Intergenic
1049052578 8:140210421-140210443 CTGCTGCTGCTGGAGGGAAGTGG + Intronic
1049913726 9:295899-295921 ATGCTGCCCATGAAGGATAGAGG + Intronic
1050927353 9:11281226-11281248 CTGCAGCTTCTGAAGTAAAGAGG + Intergenic
1053405314 9:37870138-37870160 CTGCTGGTTTTGAAGGAAGAAGG - Intronic
1053451087 9:38194705-38194727 ATGCTGCACTTGATGGATAGGGG + Intergenic
1054877693 9:70113625-70113647 CTGCTTCTCTGCAAGGAAAATGG + Intronic
1055325397 9:75123086-75123108 TTGCTGTTCTTCAAGGAGAGAGG + Intronic
1056266815 9:84905400-84905422 CTGCTTCACCTGAAGGATAGAGG + Intronic
1056345462 9:85690081-85690103 CTGGTGCTGTTGAAGGCACGGGG - Intronic
1056974492 9:91238924-91238946 CTTTTGGTCTTGGAGGAAAGGGG - Intronic
1057303430 9:93899434-93899456 CAGCTCCTCCTGAAGGGAAGAGG + Intergenic
1057413991 9:94845317-94845339 CTGCTGGTGTTGAATGAACGAGG + Intronic
1057636549 9:96774806-96774828 CTGCTGCTCCTGAAAGAGTGTGG + Exonic
1057991298 9:99772919-99772941 CTGCTTCTGTGGAATGAAAGAGG + Intergenic
1058913076 9:109539072-109539094 TGGCTGCTCTCCAAGGAAAGTGG - Intergenic
1060451702 9:123748724-123748746 TTATTGCTGTTGAAGGAAAGTGG + Intronic
1060798212 9:126526804-126526826 CAGCAGCTCTGGAAGGAATGGGG - Intergenic
1185814282 X:3140093-3140115 CAGCTGGTCATGAAGAAAAGAGG + Intergenic
1186392945 X:9179691-9179713 CTGTTGCTCTTTAAGGAGAAAGG - Intergenic
1190289715 X:48984175-48984197 GTTATGCTCTTAAAGGAAAGGGG + Intronic
1192727194 X:73765799-73765821 CTCCTGCTCCTGGAAGAAAGCGG - Intergenic
1193630511 X:83881106-83881128 CTGTTGCTATTCAAGGAAAGTGG + Intronic
1195438223 X:104870311-104870333 CTCTTGCTTTTGAAGAAAAGTGG + Intronic
1197776630 X:130122340-130122362 ATGCCCCTCTGGAAGGAAAGGGG - Intergenic
1201077141 Y:10196769-10196791 CTGCGGCGCGTGCAGGAAAGAGG + Intergenic
1201354610 Y:13083971-13083993 CTGCTACTGTTGATGCAAAGTGG - Intergenic
1201719806 Y:17084139-17084161 GTGCTGCTCTTGGAAGAAACAGG - Intergenic