ID: 1090718735

View in Genome Browser
Species Human (GRCh38)
Location 11:129453582-129453604
Sequence TCTCAATAACAAAGGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090718735_1090718739 25 Left 1090718735 11:129453582-129453604 CCTCATCCCCTTTGTTATTGAGA No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data
1090718735_1090718742 30 Left 1090718735 11:129453582-129453604 CCTCATCCCCTTTGTTATTGAGA No data
Right 1090718742 11:129453635-129453657 CTTGTGAATAGACAAAGGAGGGG No data
1090718735_1090718741 29 Left 1090718735 11:129453582-129453604 CCTCATCCCCTTTGTTATTGAGA No data
Right 1090718741 11:129453634-129453656 TCTTGTGAATAGACAAAGGAGGG No data
1090718735_1090718740 28 Left 1090718735 11:129453582-129453604 CCTCATCCCCTTTGTTATTGAGA No data
Right 1090718740 11:129453633-129453655 CTCTTGTGAATAGACAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090718735 Original CRISPR TCTCAATAACAAAGGGGATG AGG (reversed) Intergenic
No off target data available for this crispr