ID: 1090718737

View in Genome Browser
Species Human (GRCh38)
Location 11:129453589-129453611
Sequence CTGTTGATCTCAATAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090718737_1090718740 21 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718740 11:129453633-129453655 CTCTTGTGAATAGACAAAGGAGG No data
1090718737_1090718743 26 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718743 11:129453638-129453660 GTGAATAGACAAAGGAGGGGAGG No data
1090718737_1090718741 22 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718741 11:129453634-129453656 TCTTGTGAATAGACAAAGGAGGG No data
1090718737_1090718742 23 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718742 11:129453635-129453657 CTTGTGAATAGACAAAGGAGGGG No data
1090718737_1090718739 18 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090718737 Original CRISPR CTGTTGATCTCAATAACAAA GGG (reversed) Intergenic
No off target data available for this crispr