ID: 1090718739

View in Genome Browser
Species Human (GRCh38)
Location 11:129453630-129453652
Sequence TAACTCTTGTGAATAGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090718737_1090718739 18 Left 1090718737 11:129453589-129453611 CCCTTTGTTATTGAGATCAACAG No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data
1090718738_1090718739 17 Left 1090718738 11:129453590-129453612 CCTTTGTTATTGAGATCAACAGA No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data
1090718736_1090718739 19 Left 1090718736 11:129453588-129453610 CCCCTTTGTTATTGAGATCAACA No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data
1090718735_1090718739 25 Left 1090718735 11:129453582-129453604 CCTCATCCCCTTTGTTATTGAGA No data
Right 1090718739 11:129453630-129453652 TAACTCTTGTGAATAGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090718739 Original CRISPR TAACTCTTGTGAATAGACAA AGG Intergenic
No off target data available for this crispr