ID: 1090719231

View in Genome Browser
Species Human (GRCh38)
Location 11:129457139-129457161
Sequence GGTCTGGCTTAGAACTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090719218_1090719231 6 Left 1090719218 11:129457110-129457132 CCTCAGCCTTGCCCCACGACCCT No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719225_1090719231 -6 Left 1090719225 11:129457122-129457144 CCCACGACCCTGGGCTGGGTCTG No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719226_1090719231 -7 Left 1090719226 11:129457123-129457145 CCACGACCCTGGGCTGGGTCTGG No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719216_1090719231 23 Left 1090719216 11:129457093-129457115 CCTTGAACTTTATTCCACCTCAG No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719217_1090719231 9 Left 1090719217 11:129457107-129457129 CCACCTCAGCCTTGCCCCACGAC No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719221_1090719231 0 Left 1090719221 11:129457116-129457138 CCTTGCCCCACGACCCTGGGCTG No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719224_1090719231 -5 Left 1090719224 11:129457121-129457143 CCCCACGACCCTGGGCTGGGTCT No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data
1090719215_1090719231 24 Left 1090719215 11:129457092-129457114 CCCTTGAACTTTATTCCACCTCA No data
Right 1090719231 11:129457139-129457161 GGTCTGGCTTAGAACTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090719231 Original CRISPR GGTCTGGCTTAGAACTGGAC TGG Intergenic
No off target data available for this crispr