ID: 1090719573

View in Genome Browser
Species Human (GRCh38)
Location 11:129459292-129459314
Sequence GTAAATTCAGGGCAACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090719573_1090719578 13 Left 1090719573 11:129459292-129459314 CCTCACAGTTGCCCTGAATTTAC No data
Right 1090719578 11:129459328-129459350 ACATGTATCATCGCTCCTGCAGG No data
1090719573_1090719579 22 Left 1090719573 11:129459292-129459314 CCTCACAGTTGCCCTGAATTTAC No data
Right 1090719579 11:129459337-129459359 ATCGCTCCTGCAGGATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090719573 Original CRISPR GTAAATTCAGGGCAACTGTG AGG (reversed) Intergenic
No off target data available for this crispr