ID: 1090720525

View in Genome Browser
Species Human (GRCh38)
Location 11:129468072-129468094
Sequence GCTCCTTTTTCTCATGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090720525_1090720530 28 Left 1090720525 11:129468072-129468094 CCATGAACATGAGAAAAAGGAGC No data
Right 1090720530 11:129468123-129468145 GAATGCCTCTTCTCATCCAAAGG No data
1090720525_1090720527 6 Left 1090720525 11:129468072-129468094 CCATGAACATGAGAAAAAGGAGC No data
Right 1090720527 11:129468101-129468123 AGGCTGAAAATTCCAAAAACCGG 0: 25
1: 31
2: 32
3: 62
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090720525 Original CRISPR GCTCCTTTTTCTCATGTTCA TGG (reversed) Intergenic
No off target data available for this crispr