ID: 1090720527

View in Genome Browser
Species Human (GRCh38)
Location 11:129468101-129468123
Sequence AGGCTGAAAATTCCAAAAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 25, 1: 31, 2: 32, 3: 62, 4: 432}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090720523_1090720527 22 Left 1090720523 11:129468056-129468078 CCAAAGGTAGATAAATCCATGAA 0: 265
1: 456
2: 588
3: 2925
4: 4332
Right 1090720527 11:129468101-129468123 AGGCTGAAAATTCCAAAAACCGG 0: 25
1: 31
2: 32
3: 62
4: 432
1090720525_1090720527 6 Left 1090720525 11:129468072-129468094 CCATGAACATGAGAAAAAGGAGC No data
Right 1090720527 11:129468101-129468123 AGGCTGAAAATTCCAAAAACCGG 0: 25
1: 31
2: 32
3: 62
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090720527 Original CRISPR AGGCTGAAAATTCCAAAAAC CGG Intergenic
900664115 1:3802455-3802477 AGCCTGAGAATTCCAAAGTCCGG + Intergenic
901937924 1:12639778-12639800 AGGCTGAGAAGTCCCACAACAGG - Intergenic
902789546 1:18758029-18758051 AGTCTGATAATTCCAACATCTGG + Intergenic
902851727 1:19163623-19163645 AGGCTGATAATCTCAAAGACTGG - Intronic
905556902 1:38893184-38893206 AGTCTGAAAATTCCAAAGGCAGG + Exonic
908053867 1:60261773-60261795 AGGCTGGAAAATCCAAGATCAGG + Intergenic
908373472 1:63507116-63507138 AAGCTGAAAATACCAGAAACTGG + Intronic
910232629 1:85002080-85002102 ACACTGAAAATTCCAAATACTGG - Intronic
910574113 1:88739074-88739096 AGGTTAAGAATTCCTAAAACAGG - Intronic
911237751 1:95429772-95429794 AGGCTGGAAAGTCCAAGATCGGG - Intergenic
911495319 1:98624307-98624329 AGGCTGAAAATTCTAAAAACCGG - Intergenic
911545397 1:99210056-99210078 AGGCTGGAAAGTCCAAGAGCAGG - Intergenic
912622484 1:111177178-111177200 AGGCTGGACATTCCAACAACAGG - Intronic
912835395 1:112992075-112992097 ATGATAAAAATTCCAAAAATAGG + Intergenic
914458826 1:147862690-147862712 AAGCTGAAAATTCTAAAAACCGG + Intergenic
916419679 1:164625155-164625177 AGGATTAAAATGCCAAAAAGAGG + Intronic
917563176 1:176181455-176181477 AGGCTGTCAATTCCAACATCAGG - Intronic
918786482 1:188769898-188769920 GCGCTGAAAATTCCAAAAGCCGG + Intergenic
918906682 1:190505474-190505496 AGGCTGACAATTCCAAAAACCGG - Intergenic
918930468 1:190849165-190849187 AAGCTGAAAATACCAAAAGTTGG - Intergenic
919042311 1:192406111-192406133 ATGCTGAAAATTAGAAAAACTGG - Intergenic
919332096 1:196184851-196184873 AGCCTGAGAATTCTAAATACAGG - Intergenic
919338978 1:196279049-196279071 AGGCTGAGAAGTCCAAGATCAGG - Intronic
919602020 1:199633904-199633926 AGGCTGAAAATTCCAAAAACCGG + Intergenic
919972610 1:202590823-202590845 GGGCTGAAAACTTCAAAATCAGG - Exonic
921484741 1:215702893-215702915 AGGCTGAAAATTCCAAAAACTGG - Intronic
922861836 1:228825225-228825247 TGGCTGAAAATTCCCAAATTTGG - Intergenic
923225730 1:231937522-231937544 AGGCTGATTATTTCAAAACCAGG + Intronic
923306784 1:232695897-232695919 AGGCTCAAACTTCCACATACAGG + Intergenic
923670531 1:236036848-236036870 AGGCTGAGAAGTCCAAGATCAGG - Intronic
923853559 1:237821582-237821604 AGACTGAAAATTCCAAAAACTGG + Intronic
924396207 1:243623774-243623796 AGGTTGAAAATTCCCAAGACAGG - Intronic
1063319448 10:5039069-5039091 AGCCTGAGAATTCCAAAGTCAGG + Intronic
1064170671 10:13029397-13029419 AAGCTGAAAATTCTAAAAACCGG + Intronic
1064904555 10:20331498-20331520 AGGCTGAAAAGTCCAGGAACGGG - Intergenic
1065638669 10:27757461-27757483 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
1065991485 10:31014305-31014327 AGGCTGAGAAGTCCAAGATCAGG + Intronic
1066272458 10:33837018-33837040 AGGCAAGAATTTCCAAAAACTGG - Intergenic
1066508457 10:36068414-36068436 AGTCTGCAAATTCAAAGAACAGG + Intergenic
1067162560 10:43839739-43839761 AGGCTGAGAAGTCCAATATCAGG + Intergenic
1067252138 10:44595197-44595219 ATGCTGAAAATTCCAAAAGCCGG + Intergenic
1067286268 10:44909675-44909697 AGGCGGAAAAATACAAAAAACGG + Intergenic
1067659506 10:48223941-48223963 AGGTTGGAAAGTCCAATAACAGG - Intronic
1069373375 10:67769751-67769773 TGGCTGGAAATGCCACAAACTGG - Intergenic
1069577170 10:69539021-69539043 AGGCTGAAAAGTCCTAAATTTGG + Intergenic
1070057291 10:72947787-72947809 AGGCTGGGAATTCCAAGATCAGG + Intronic
1070709349 10:78667386-78667408 AGGCTGAAACTTCCAAAAACCGG + Intergenic
1070995731 10:80778974-80778996 AGGATGAACTTTTCAAAAACTGG + Intergenic
1071838674 10:89445663-89445685 AAGCTGAAAATTCTAAAAACTGG + Intronic
1072067615 10:91885947-91885969 AGGCTGAAAAGACCAAGATCTGG - Intergenic
1072200509 10:93153810-93153832 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
1072277783 10:93839803-93839825 AGGCTGAAAAGTCCCTCAACAGG + Intergenic
1072868275 10:99087777-99087799 ATGCTGATAATTTTAAAAACAGG + Intronic
1073232803 10:101986753-101986775 ATGCTTCAAATTCTAAAAACTGG + Intronic
1073664561 10:105516110-105516132 ATGCTGAAAATACAAAAAAAAGG + Intergenic
1074000603 10:109368287-109368309 AAGTTGAAAATTCTAAAAATCGG + Intergenic
1074631360 10:115258698-115258720 AAGGTGAAAATTCTAAAAATTGG - Intronic
1074777478 10:116776748-116776770 ATGCTTAAAACTCTAAAAACTGG + Intergenic
1075312227 10:121424007-121424029 GGGCTGAAAAGTCCAAGATCAGG - Intergenic
1076211778 10:128653399-128653421 AGGCAGGAAATTACAAAAGCAGG - Intergenic
1076229263 10:128806608-128806630 AGGCTGCAGAATCCAAACACGGG + Intergenic
1076244618 10:128937060-128937082 AGGCTGAGAAGTCCCACAACAGG + Intergenic
1077400555 11:2354327-2354349 AGGCTGAAAATTCCCACAATAGG - Intergenic
1077655570 11:4016127-4016149 AGGCTGAAAATTCCAAAAACTGG - Intronic
1078128126 11:8587974-8587996 AGGCTGAGAAGTCCAAGACCAGG + Intronic
1078248097 11:9594677-9594699 AGGCTGAGAATTAGGAAAACTGG + Intergenic
1078468147 11:11565540-11565562 AGGCTGGAAATTCCACAAGATGG + Intronic
1080346172 11:31328267-31328289 TAGCTGAAAATGGCAAAAACAGG - Exonic
1081154426 11:39671777-39671799 AGGATGAATTTTCCAAAAAAAGG - Intergenic
1081221705 11:40470443-40470465 AGGCTGAGAATTCCAAAAACCGG + Intronic
1081331895 11:41811648-41811670 AGGCTGCAAACTCCTAAAGCTGG + Intergenic
1081600245 11:44487906-44487928 AGGATGAAAAATGGAAAAACAGG - Intergenic
1081643756 11:44776110-44776132 AGGCTGTAAAGCCCAATAACTGG - Intronic
1081890763 11:46540441-46540463 AGGCACAATATTCCAAAACCAGG + Intronic
1082116777 11:48337554-48337576 AGGGTGAAAAGTCCCAAAGCAGG + Intergenic
1082287040 11:50329191-50329213 AGGCTGAAAATTCTAAAAATTGG - Intergenic
1082968073 11:58989005-58989027 AAGCTGAAAATTCCAAAATCTGG - Intronic
1083982901 11:66188508-66188530 AGGCTGATAATTCCAAGTGCTGG - Intronic
1086197269 11:84155508-84155530 TGGCTGCAAATTCCAAAGCCTGG + Intronic
1086263330 11:84967766-84967788 AGACTGAAAATTGCATAACCTGG + Intronic
1086344077 11:85877680-85877702 AGGCAAAAAATTCCAAAGAGTGG - Intronic
1087003348 11:93444128-93444150 AAGCTGAAAATTCCAAAAACTGG - Intergenic
1087494925 11:98879458-98879480 AGGCTGGAACTTCCAAGATCAGG + Intergenic
1087604325 11:100358027-100358049 AGGCTGGACTTTGCAAAAACAGG + Exonic
1088008438 11:104969987-104970009 CCGCTGAAAATTCCAAAAGCTGG + Intergenic
1088017943 11:105082543-105082565 CCGCTGAAAATTCCAAAAGCTGG + Intronic
1088020513 11:105112521-105112543 CCGCTGAAAATTCCAAAAGCTGG + Intergenic
1088854433 11:113734392-113734414 AGTCTGATAATTCCAAATACTGG + Intronic
1090567237 11:128007541-128007563 ATGCTGAAAACTCAAAAACCAGG + Intergenic
1090720527 11:129468101-129468123 AGGCTGAAAATTCCAAAAACCGG + Intergenic
1092316573 12:7422349-7422371 ATGCTGAAAATTCCCAAAACCGG + Intronic
1092691013 12:11109730-11109752 AGGCTGAAAATTCCAAAAACCGG + Intronic
1093010303 12:14100505-14100527 AGGCTGACAAGTCCAAGATCAGG + Intergenic
1093085831 12:14866416-14866438 AAGCTGAAAATTCTAAAAACTGG - Intronic
1094072186 12:26429840-26429862 ATGCTGAAAAGTCAAATAACTGG - Intronic
1094083099 12:26559375-26559397 AGGCTGCAAAGTCCAAGATCAGG + Intronic
1094431933 12:30379605-30379627 ATGCTGAAAACTCAAAAAGCCGG - Intergenic
1094883678 12:34835887-34835909 CAGCTGCAAATTCCAAAAAAAGG - Intergenic
1094886702 12:34884480-34884502 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1094913401 12:35316883-35316905 CAGCTGCAAATTCCACAAACAGG - Intergenic
1094932152 12:35620713-35620735 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1094936350 12:35688950-35688972 CAGCTGCAAATTCCACAAACAGG - Intergenic
1094945064 12:35830270-35830292 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1094949689 12:35905338-35905360 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1094955465 12:35998751-35998773 CAGCTGAAAATTCCACAAAAAGG - Intergenic
1094976324 12:36335060-36335082 CAGCTGCAAATTCCAAAAAAAGG - Intergenic
1094978829 12:36375481-36375503 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1094991464 12:36580699-36580721 CAGCTGCAAATTCCACAAACAGG - Intergenic
1095005692 12:36810732-36810754 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1095010167 12:36883411-36883433 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1095010538 12:36889527-36889549 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1095015597 12:36971174-36971196 CAGCTGCAAATTCCACAAACAGG - Intergenic
1095019080 12:37027552-37027574 CGGCTGCAAATTCCACAAAAAGG - Intergenic
1095043929 12:37477749-37477771 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
1095124027 12:38453888-38453910 AGGCAGAAATTTGGAAAAACTGG - Intergenic
1095488616 12:42709243-42709265 GGGCTGAAAATTCAAAAACCAGG + Intergenic
1096734372 12:53641085-53641107 AGGCTGAAAAGTCCAAGGTCAGG - Intronic
1097477925 12:60082349-60082371 TGGCTGAAACTTCCCAAATCTGG - Intergenic
1097497178 12:60354814-60354836 AGGCTGAGAAATCCAAGATCAGG + Intergenic
1097651186 12:62298869-62298891 TGGCTGAAACTTCCTGAAACTGG + Intronic
1097775091 12:63635346-63635368 AAGCTGAAAATTCTAAAAACCGG + Intronic
1098016800 12:66113827-66113849 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
1098467067 12:70799771-70799793 ATGCTGTAAATTTAAAAAACGGG - Intronic
1099010665 12:77287257-77287279 AGGCTGAAAATTCCAAAAACCGG + Intergenic
1099683572 12:85858705-85858727 AGGCTGAAAGTTACAGAAATAGG + Intergenic
1100375030 12:94007391-94007413 AGGCTGAAAATTCCAAAAACTGG - Intergenic
1101764870 12:107688191-107688213 AGTCTTAAAACTCCAAAGACTGG - Intronic
1102944635 12:116975317-116975339 AGGCTGGAAAGTCCAAGATCAGG + Intronic
1103255329 12:119537494-119537516 AAGCTGAAAATTCTAAAAACTGG - Intronic
1103843455 12:123884446-123884468 AGGCTGGGAATTCCAAGATCAGG + Intronic
1103852209 12:123940624-123940646 AGACTGAAATTTCCAGAAAGGGG - Intronic
1104206237 12:126641779-126641801 AACCTGAAAATTCTAAAAACCGG - Intergenic
1105316588 13:19270883-19270905 ATGCTGAAAATTCCCAAAACCGG + Intergenic
1106160783 13:27199533-27199555 AGGCTGAGAGGTCCCAAAACAGG - Intergenic
1107210717 13:37851390-37851412 AGGCTGATAACTCCAATAACAGG - Intronic
1107793119 13:44022640-44022662 ATGGTGGAAAATCCAAAAACAGG - Intergenic
1108249325 13:48549325-48549347 AGGCTGGCAAATCCAAAATCAGG - Intergenic
1108264108 13:48687269-48687291 AGGCTGAGAAGTCCCACAACAGG - Intronic
1109806735 13:67453347-67453369 AAGCTGAAAATTCTGAAAACTGG + Intergenic
1110285070 13:73740329-73740351 AGGCTGCAAAGTCCAAGATCAGG - Intronic
1110441519 13:75531696-75531718 AGTCTGAAAATTCCAAGTATTGG + Intronic
1110729139 13:78859983-78860005 AAACTGAAAATTCTAAAAATCGG - Intergenic
1110829484 13:80013595-80013617 TGGCTGAAAAGTCCAAAATTGGG - Intergenic
1111507326 13:89209497-89209519 ATTATCAAAATTCCAAAAACTGG - Intergenic
1111847520 13:93530208-93530230 GGACTGAAAATTGCAAAACCTGG + Intronic
1112411956 13:99172399-99172421 AAGCTGAAAATTCTAAAAATCGG - Intergenic
1113166409 13:107448368-107448390 AGACTTAAAATTCCTAATACTGG - Intronic
1114395005 14:22349970-22349992 AAGCTGAAAATTCTAAAAATTGG + Intergenic
1114409028 14:22483481-22483503 ATGCTGAAAATTCTATAAGCAGG + Intergenic
1114432795 14:22677116-22677138 CAGCTGAAAATTCTAAAAATTGG - Intergenic
1114681995 14:24492477-24492499 AAGCTGAAAATTCTAAAAATCGG + Intergenic
1115300189 14:31876795-31876817 AGGCTGAGAAGTCCAAGATCGGG + Intergenic
1116077769 14:40133761-40133783 AGGCTGATAATTCCACCAAAAGG - Intergenic
1116290360 14:43028070-43028092 ATGTAGAAAATTACAAAAACAGG + Intergenic
1116765275 14:49062817-49062839 AGCCTGAAAATTCCAAAAACTGG + Intergenic
1117305627 14:54470741-54470763 AGGCTGGAAAGTCCCAAGACAGG + Intergenic
1117492605 14:56265930-56265952 AGACTGACAATTCCAAAAGTTGG + Intronic
1118520204 14:66574969-66574991 AGGCTGAAAAATCCTACAACAGG - Intronic
1119539860 14:75430867-75430889 AGTCTGAAAATTCCAAGACTGGG - Intronic
1120192571 14:81452515-81452537 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
1120307583 14:82790074-82790096 AAGCTGAAAAATCGAAACACAGG + Intergenic
1120614220 14:86682427-86682449 ATGCTGAAAATTACAAAATACGG + Intergenic
1121072933 14:91041163-91041185 AAGCAGAAGATTTCAAAAACAGG + Intronic
1121401750 14:93685376-93685398 AGGATTAATATTCCAAAAGCAGG + Intronic
1121969152 14:98340547-98340569 AGGCTGAAAATTCCCAATACAGG - Intergenic
1202942472 14_KI270725v1_random:165382-165404 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
1123403608 15:20008097-20008119 GGGCAGAGAATTCCATAAACTGG - Intergenic
1123512944 15:21014742-21014764 GGGCAGAGAATTCCATAAACTGG - Intergenic
1123876161 15:24626172-24626194 AGGCTGAAAAGTCCCAAGGCAGG + Intergenic
1124124009 15:26920138-26920160 TGGCTGAAAATTTCCAAACCTGG - Intronic
1126290945 15:47078114-47078136 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
1126591691 15:50346669-50346691 AGGCTGAGAAGTCCAAAATAAGG + Intronic
1126872285 15:53002482-53002504 TGGCTGAATAGTACAAAAACAGG - Intergenic
1127722688 15:61718369-61718391 AGGCTGAGAAGTCCAAGATCAGG - Intergenic
1127906309 15:63379003-63379025 AGGATGAGAACTCCAACAACAGG - Intronic
1130572183 15:85056894-85056916 AAGCTGAACATTCTAAAAATCGG - Intronic
1130774911 15:86968782-86968804 AGGCTGGAAAGTCCACAATCAGG + Intronic
1131362193 15:91803131-91803153 ATGCTGACAAATCCAGAAACAGG - Intergenic
1133433882 16:5762670-5762692 ATAATGAAAATTCCAATAACGGG + Intergenic
1135041374 16:19119841-19119863 AGGAAGGAAATGCCAAAAACTGG - Exonic
1135145565 16:19959845-19959867 ATGCTAAAAATTCCAGGAACTGG + Intergenic
1135178620 16:20253540-20253562 AGGCTGGGAATTCCAAGATCAGG + Intergenic
1137335609 16:47546172-47546194 AAGCTGAAAGTTCTAAAAACAGG - Intronic
1137976691 16:53038079-53038101 AGTCTGAAAATCCCAGAACCAGG + Intergenic
1138850045 16:60617155-60617177 AACCTGAACATTCCAAAGACAGG + Intergenic
1140576304 16:76173889-76173911 ATGGTGAAAATTCCAAGGACAGG + Intergenic
1140728838 16:77838167-77838189 ATGCTGAGAACTCCAAACACAGG + Intronic
1143176620 17:4959272-4959294 GGGAAGAAAATTCCAAGAACGGG + Exonic
1144322482 17:14142969-14142991 AGGCTGAAAATTCTTATAGCAGG - Intronic
1144552065 17:16249564-16249586 AGGCTGAGAAGTCCCACAACAGG + Intronic
1144954955 17:19014477-19014499 TGGCGGAAAATTCCAGAGACTGG + Intronic
1146536668 17:33658532-33658554 AGGCTGGAAAGTCCAAGACCAGG + Intronic
1146672109 17:34746809-34746831 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
1146746207 17:35333015-35333037 AGGCTGAAAATTCCCAAAACCGG - Intergenic
1147742942 17:42679041-42679063 AGTCTGAACATTCCAATAGCGGG + Exonic
1147836948 17:43339917-43339939 AGTCTGAGAATTCCAAAGTCTGG + Intergenic
1148034407 17:44647774-44647796 ATACTGACAATTCCAAATACTGG + Intergenic
1148952681 17:51327510-51327532 AAGCTGAAAATTCTAAAAACTGG + Intergenic
1148981146 17:51575757-51575779 ATGCTGAGACTTCCAAAAACTGG + Intergenic
1149225421 17:54464977-54464999 AAACTGAAAATTCTAAAAACTGG - Intergenic
1150501617 17:65656362-65656384 AAACTGAAAAATCCAAAGACAGG - Intronic
1151288522 17:73131489-73131511 AGCCTGAAACTTCCAAAGAAAGG + Intergenic
1151950025 17:77346969-77346991 AGGCTGGGAAGTCCAAAATCAGG - Intronic
1152791877 17:82284515-82284537 AGGATTAAAAACCCAAAAACTGG + Intergenic
1153097280 18:1421444-1421466 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
1153518842 18:5932784-5932806 AGGCTGAAAATTCTTAATCCAGG - Intergenic
1153610380 18:6878677-6878699 AGGCTGAAACTACATAAAACTGG - Intronic
1153702750 18:7712419-7712441 AGGCTGAAAATTGCAAAAACTGG + Intronic
1155156317 18:23160731-23160753 ACTCTGAAAATGTCAAAAACAGG + Intronic
1155395348 18:25380508-25380530 AGGCTGAAAATTCCAAAAACCGG + Intergenic
1155779438 18:29812175-29812197 ACTCTGACAATTCAAAAAACTGG + Intergenic
1156049847 18:32919483-32919505 AGTCTGAAAAGACCAAAGACTGG - Intergenic
1156329357 18:36104855-36104877 AGGCTGAGAAGTCCCACAACAGG - Intergenic
1157375724 18:47162562-47162584 AGGATTAAAAGTTCAAAAACAGG + Intronic
1157962213 18:52167915-52167937 AGGCTGTAGATTGCAAAAGCAGG + Intergenic
1159264636 18:66064612-66064634 AGCCAGAAAATTCCAAGTACTGG + Intergenic
1159542525 18:69796178-69796200 AGGATGAAAATTCCAAAGAAGGG + Intronic
1159624769 18:70679821-70679843 ACTATGAAAATTCCAAACACTGG + Intergenic
1160567036 18:79792637-79792659 AGGCTGCAGATGCCAGAAACGGG + Intergenic
1162210966 19:9091755-9091777 AGACTGAAAATTTCAAACACAGG + Intergenic
1162438679 19:10679480-10679502 AGGGTGCAACTGCCAAAAACTGG - Intronic
1163225822 19:15960486-15960508 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
1164195195 19:22950575-22950597 AAGCTGAAAATTCTAAAAACCGG + Intergenic
1164258076 19:23546704-23546726 AGGGTGACAATTCTAAAAATAGG + Intronic
1164282372 19:23780263-23780285 AGGATGACAATTCTAAAAATTGG - Intronic
1164295268 19:23904193-23904215 ATGCTTAAAAAACCAAAAACGGG + Intergenic
1164312971 19:24062269-24062291 AGGATGACAATCCTAAAAACTGG - Intronic
1164747089 19:30624321-30624343 AGGCTCTAGATTCCAGAAACAGG - Intronic
1164819958 19:31242279-31242301 AGGCTGAGAAGTCCTACAACAGG + Intergenic
1167048302 19:47064489-47064511 AGGCTGAATATTCCAAGAGGAGG + Exonic
1168616982 19:57846189-57846211 AGTCAGAAAATTCCAGAAAATGG - Exonic
925749592 2:7075654-7075676 AGGCTGAAAAGTCCAAGATCAGG - Intergenic
926074641 2:9932250-9932272 AAGCTGAAAATTCTAAAAACTGG - Intronic
926078172 2:9959973-9959995 AGGCTGAAGCTTCAAGAAACAGG - Intronic
926372512 2:12194178-12194200 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
927066707 2:19479179-19479201 AAGGGGAAAATTCCAAAAAATGG - Intergenic
928488398 2:31755416-31755438 ATGCTGAAAATTCCAAAAACCGG + Intergenic
928850146 2:35735212-35735234 ACGCTGAAAACTCAAAAAGCTGG + Intergenic
929022631 2:37568579-37568601 AGGCTGAGAAGTCCAAGATCAGG - Intergenic
929646243 2:43631534-43631556 AGGTTGAACATTCCAATAGCAGG - Intergenic
929741564 2:44607131-44607153 AGGCTGCAAATTCCCATGACAGG + Intronic
929884419 2:45865756-45865778 AGGCTGAGAAGTCCAAGATCAGG - Intronic
930493712 2:52110284-52110306 AGGCTGAAACTTCAAAAAGAAGG - Intergenic
930572153 2:53100674-53100696 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
930572223 2:53101775-53101797 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
931927872 2:67094818-67094840 AGCCTGAAAAGTCTAGAAACAGG - Intergenic
931986085 2:67744042-67744064 AAGCTGAAAATTCTAAAATCCGG - Intergenic
932649477 2:73539440-73539462 AAACTGAAAATTCTAAAAATCGG + Intronic
933225272 2:79741128-79741150 AGGCTGAGAATTCCCAAGAGTGG + Intronic
934093011 2:88570750-88570772 AGTCTGAAAATTATGAAAACTGG - Intronic
934637252 2:96001442-96001464 AAGCTGAAAATTCTAAAAATCGG - Intergenic
934886731 2:98031734-98031756 AGGCTGAGAAGTCCCATAACAGG + Intergenic
935061755 2:99614756-99614778 AAGCTGATAAATCCAAAAGCAGG - Intronic
935505996 2:103903743-103903765 TAGCTGATAATTCCAAAATCTGG + Intergenic
936340439 2:111626822-111626844 AAGCTGAGAAAACCAAAAACAGG + Intergenic
936499845 2:113058617-113058639 AGGCTGAACATTCCCTAAGCAGG + Intronic
936813705 2:116433564-116433586 AGCCTGAAAGTTCAAAAAATTGG - Intergenic
938320857 2:130362305-130362327 AGGCTGAATATTCCAATTAAAGG - Intronic
938912890 2:135901581-135901603 AGGCTGAGAAGTCCAAGATCAGG - Intergenic
939381918 2:141447493-141447515 AGGCTGAAAATTCCAAAAACTGG - Intronic
939472707 2:142644779-142644801 AGGCCGAGATTTCCAAACACAGG - Intergenic
939713139 2:145548762-145548784 AGGCTGAAATTTCCAGACAAAGG - Intergenic
940002203 2:148977564-148977586 AGAATGAAACCTCCAAAAACTGG - Intronic
940570089 2:155420194-155420216 AGGCTGTAAATCCAAAGAACTGG - Intergenic
940863566 2:158794873-158794895 ATGCTTATAATTGCAAAAACTGG + Intergenic
940934468 2:159475635-159475657 GGGCTGAAAATTCCAAAAACCGG - Intronic
941154807 2:161963071-161963093 ACACTGAAAATTGCAAAAATTGG + Intronic
941234543 2:162953732-162953754 AGGCTTAAAATTTCTAAAACTGG - Intergenic
941694979 2:168541327-168541349 AGTCTGTAACTTCCAAAATCTGG - Intronic
942322325 2:174746373-174746395 AGGCTGAGAAGTCCCACAACAGG - Intergenic
942898877 2:181090278-181090300 AGGCTGAAAATTTCAAAAACCGG + Intergenic
943060247 2:183036100-183036122 AGGCTGAAGCTTCCCAAAACAGG + Intronic
943084876 2:183299883-183299905 AGGCTGAAAATTCCAAAAACCGG - Intergenic
943359532 2:186901192-186901214 AAGCTGAAAATTCTAAAAATCGG - Intergenic
943382063 2:187162939-187162961 AGGGGGAAAATTCCAAAAAGGGG + Intergenic
943868450 2:192959559-192959581 AGGTTGGAAATTCCAAAATAGGG + Intergenic
944146748 2:196514525-196514547 AGGCTGTCAGTTCCATAAACTGG + Intronic
945856064 2:215071529-215071551 AGACTGAGAATTTGAAAAACAGG + Intronic
946497969 2:220215319-220215341 AGGCTGCAAATTCAAATTACAGG - Intergenic
946517008 2:220423520-220423542 TGGCTCAAAATGCCATAAACTGG + Intergenic
946567798 2:220986598-220986620 AGGCTGAAGATTCAAAAACGTGG - Intergenic
946891046 2:224276805-224276827 AGGCTGAAAATTCCAGAGTATGG + Intergenic
947082605 2:226415466-226415488 AGGCTGAGAAGTCCAAGATCTGG - Intergenic
947156870 2:227171627-227171649 AGGCTGGAAAGTCCAAGATCAGG + Intronic
947914857 2:233824521-233824543 CCGCTGAAAATTCCAAACTCAGG - Intronic
947967773 2:234296520-234296542 AGGCTCCAAACTCCACAAACTGG - Intergenic
948397368 2:237655886-237655908 AGACTCACAATTCCACAAACAGG + Intronic
1170000700 20:11610057-11610079 AGGCTGAATTATCCAAAATCAGG + Intergenic
1171802676 20:29640091-29640113 AGGCTGGAAATTCCAAGATCAGG + Intergenic
1172594215 20:36138847-36138869 AGGCAGAAAATTCTATAGACAGG - Intronic
1172828384 20:37810208-37810230 AGGCTGAGAAGTCCAAGATCAGG + Intronic
1173883123 20:46433852-46433874 AGGCTGAGAAGTCCCACAACAGG - Intergenic
1175031024 20:55954225-55954247 AGGCTGGGAAGTCCAAAATCAGG + Intergenic
1175395889 20:58661318-58661340 AGGCAGCAAGTTCCAGAAACTGG + Intronic
1175520157 20:59597574-59597596 AGGCTGAAACTACCCAAATCAGG - Intronic
1176514691 21:7775195-7775217 AGGCTGAGAATTTCAAAGCCAGG + Intergenic
1178648804 21:34405719-34405741 AGGCTGAGAATTTCAAAGCCAGG + Intronic
1178903664 21:36617584-36617606 AAACTGAAAATTCTGAAAACCGG + Intergenic
1179196599 21:39169761-39169783 AGGCTGAAAAGTCCCACAACAGG - Intergenic
1180928389 22:19572087-19572109 AAGCTGAGAATGACAAAAACAGG - Intergenic
1181928954 22:26383891-26383913 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
1182569419 22:31225414-31225436 AGGCTGAAAGTTCTAGAAAAAGG + Intronic
1183021372 22:35030028-35030050 AGGCTGAAAATTCCAAAAACCGG - Intergenic
1183368618 22:37420007-37420029 CGGCTGCAAATTCTAAACACAGG + Intronic
949232309 3:1765884-1765906 AGGCTGGAAAATCCAAGATCAGG + Intergenic
950807647 3:15620883-15620905 AGGCTGAAAAGTCCAATAACAGG + Intronic
951006121 3:17617982-17618004 AAGCTGAAAGTTCTAAAAACTGG - Intronic
951439658 3:22707971-22707993 AAGCTGAAAATTCTAAAAACCGG + Intergenic
951934132 3:28002828-28002850 AGGCTGAGAAGTCCAAATATAGG - Intergenic
953015129 3:39067353-39067375 AGGCAGAAAATTTGATAAACTGG - Intronic
953040978 3:39254414-39254436 AGGCTGAGAATTCCAAGACAAGG - Intergenic
953231225 3:41066624-41066646 AGCATCAAGATTCCAAAAACAGG + Intergenic
953579758 3:44143392-44143414 AGACTGAAAATTACAAAAAGAGG + Intergenic
953580790 3:44154286-44154308 AGGCTGAAACTTCCAATATGAGG + Intergenic
954508076 3:51096723-51096745 AGGCTGAAAATTCCAAAAACCGG - Intronic
954804671 3:53210488-53210510 AGGCTGAAATTCTCAAAAAACGG - Intergenic
955657709 3:61262916-61262938 AGGCTGAAAATTCCAAAAACTGG - Intergenic
956207556 3:66770574-66770596 AGGCTGAAAATTCCAAAAACTGG - Intergenic
956875397 3:73457880-73457902 AGGCTGGGAATTCCATAATCAGG - Intronic
956906264 3:73768835-73768857 ATGTTAAAAATTCCAGAAACTGG + Intergenic
957167412 3:76692433-76692455 AGTCTGTAAATCCCAAAGACAGG + Intronic
957176226 3:76813752-76813774 ATGCAGAAAATGCCAAAAATTGG - Intronic
957491758 3:80936269-80936291 AAGCTGAAATTTCCTAGAACAGG + Intergenic
957576796 3:82017999-82018021 AGACTGACAATACCAAATACAGG - Intergenic
958479824 3:94631680-94631702 AAGCTGAAAATTCTAAAAACAGG + Intergenic
958743544 3:98105339-98105361 AGACTGAAAATACAAAAACCAGG - Intergenic
958844330 3:99247622-99247644 AGTCTGAAAATACCAAATATTGG + Intergenic
959045396 3:101467764-101467786 AAGCTGAAAATTCTAAAAATCGG + Intronic
959219800 3:103502599-103502621 AGGCTGAAAATGAAAGAAACTGG - Intergenic
959815923 3:110672618-110672640 AGGCTGAAAATTCCAAAAGCCGG + Intergenic
959834756 3:110905340-110905362 AGGCTGAGATTTCAAAGAACTGG + Intergenic
960124825 3:113986927-113986949 AGGCTGCAAAGTCCAAGATCAGG - Intronic
960278289 3:115751932-115751954 AGGCTGAAAATTCCAAAAACCGG + Intergenic
960690685 3:120342877-120342899 AGGCTGGGAATTCCAAGATCAGG - Intronic
960977671 3:123191349-123191371 AGTATGAAAATTGCCAAAACTGG - Intronic
962143137 3:132811521-132811543 AGGCTGAGAAGTCCCATAACAGG - Intergenic
962191071 3:133311793-133311815 AAGCTGAAAATTCTAAAAACCGG - Intronic
963619350 3:147586086-147586108 AGGCTGAAAAATTGAGAAACAGG - Intergenic
963680133 3:148364058-148364080 AGGCTGGAAAGTCCAAGAGCAGG + Intergenic
963976434 3:151484861-151484883 AGGCTGAAAATTCCAAAAACTGG + Intergenic
964715363 3:159715308-159715330 AAGCTGAAACTTCTAAAAATCGG + Intronic
964904953 3:161708125-161708147 AGGCTGAAAATTCCAAAACCCGG + Intergenic
965115443 3:164482360-164482382 AGTCTGAAAAGTCCCACAACAGG + Intergenic
965342975 3:167512520-167512542 ACACTGAAAATTCAAAAAGCTGG + Intronic
965643861 3:170859548-170859570 AGCCTGAGAATTCCAAAGTCTGG - Intronic
966087388 3:176085056-176085078 AGGCTGGGAAGTCTAAAAACAGG + Intergenic
968588340 4:1444938-1444960 AGTGTGATAATTCCAACAACTGG + Intergenic
969668666 4:8576994-8577016 TGAATGAAACTTCCAAAAACGGG - Intronic
969970908 4:11047335-11047357 AGGCTGAAAATTCCAAAAACCGG - Intergenic
970994371 4:22248682-22248704 AGGCTGAGAATTCCAAATCAAGG + Intergenic
971034709 4:22680601-22680623 AGACTGAAAGTTCAAAAAGCAGG + Intergenic
972372335 4:38437285-38437307 ATGCTGAAAATTTCAAAACCCGG - Intergenic
972770431 4:42192371-42192393 AGGAAGAAAATTCCAAATAGAGG - Intergenic
973764892 4:54153956-54153978 AGGCTGAGAAGTCCAAATCCAGG - Intronic
973805133 4:54518409-54518431 AGGCTGAGAAGTCCAAGAGCAGG - Intergenic
974195212 4:58565376-58565398 AGGCTGAAAATTTCCACAATAGG - Intergenic
974251652 4:59393595-59393617 AGGCTGAACATTCCAAAACCCGG - Intergenic
974439661 4:61899731-61899753 AGGCTGGAAAGTCCAAGATCAGG + Intronic
974567001 4:63590659-63590681 AAGCTGAAAATTCCAAAAACCGG + Intergenic
974655291 4:64811325-64811347 AGGCTGAAGATTTAAAAGACAGG - Intergenic
975364870 4:73517914-73517936 AAGCTGAAAATTCTAAAAACGGG - Intergenic
975726821 4:77300569-77300591 AAGCTGAAAATTCTAAAAATCGG - Intronic
975742582 4:77443741-77443763 AGGCTGAAAAGTCCCATATCAGG - Intergenic
975884407 4:78947248-78947270 ATACTGAACAGTCCAAAAACGGG - Intergenic
975947888 4:79729887-79729909 AGGATGAAAATTCAAAAAAGTGG + Intergenic
976179220 4:82383344-82383366 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
976431866 4:84971793-84971815 AGGCTGAGAAGTCCCACAACAGG + Intergenic
976552484 4:86412985-86413007 AAGCTGAAAATGCCAAAAACCGG - Intronic
976655803 4:87488178-87488200 AGCCTGAAAATTCCAAAAATGGG - Intronic
976712960 4:88092891-88092913 AGGTTAAGAATTCCAAAACCAGG + Intronic
976843920 4:89464838-89464860 AGGCTGCAAAGTCCAAGAACTGG - Intergenic
977187343 4:93955992-93956014 AGGCTGGGAATTCCAAGATCAGG - Intergenic
977194827 4:94045513-94045535 AAGCTGAAAATTCTAAAAACCGG + Intergenic
977843891 4:101743970-101743992 AAGTTGAAAATTCTAAAAATCGG - Intronic
978012849 4:103708571-103708593 AAGCTGAAAATTCCAAAAATCGG + Intronic
978104647 4:104886836-104886858 AGGCTAAAAAGTCCAAGAAGAGG - Intergenic
978139194 4:105298110-105298132 AGGTTGAAAATTCCAAAAACTGG + Intergenic
978158784 4:105520662-105520684 ATGCTGCAAATTTCGAAAACAGG + Intergenic
978453633 4:108863993-108864015 AGGCTGAGAAGTCCCACAACAGG - Intronic
978699652 4:111627536-111627558 AGGCTGAACATTCCAAAAACCGG - Intergenic
978765151 4:112397728-112397750 ATGCTGGAGATTCCAAATACTGG + Intronic
979526366 4:121721563-121721585 AGGCTGAAAAGACCAAGATCAGG - Intergenic
979613277 4:122712182-122712204 AGGCTGAAAAGTTCCACAACAGG - Intergenic
980483054 4:133414397-133414419 AGGCTGAGAAGTTCAAAATCAGG - Intergenic
981509060 4:145535017-145535039 AGGATGAAAATACCAAAAATAGG + Intronic
981921367 4:150088295-150088317 AGGTAGAAACTTCCAGAAACTGG - Intronic
982183848 4:152776856-152776878 AGGCTGTAAGATCCAAAAACAGG + Intronic
982861535 4:160456935-160456957 AGGCTGAAAAGTCCCACAATTGG - Intergenic
982876898 4:160661893-160661915 AGGCTGAGAAGTCCTACAACAGG - Intergenic
983021034 4:162675627-162675649 AGGGTGAAAAATCCCCAAACAGG - Intergenic
983321358 4:166199979-166200001 AAGCTGAAAATTCAAAGAAGTGG + Intergenic
984103767 4:175518276-175518298 AGGCTGAGAAATCCCACAACAGG - Intergenic
984110463 4:175606868-175606890 GGGCTGAAAAGTCCAAGATCAGG + Intergenic
986529796 5:8724557-8724579 AGGCTGGAAAGTCCAAGATCAGG + Intergenic
986986062 5:13502079-13502101 AGGCTGGAAAATCCAAGAACAGG - Intergenic
988047322 5:25973185-25973207 AAGCCGAAAATTCCCCAAACGGG + Intergenic
988173527 5:27690806-27690828 AGGCTAGAAAGTCCAAAATCAGG + Intergenic
988220318 5:28337073-28337095 AGGCTGCAAATACCAAATATGGG - Intergenic
988402234 5:30776500-30776522 AGGCTGAAAATTCCAAAAATCGG + Intergenic
988627906 5:32897960-32897982 ACGCTGAAAATTCCAAAAACTGG - Intergenic
988687715 5:33540892-33540914 AAGGTGAAAATTCTAAAAACTGG + Intronic
989585705 5:43072642-43072664 AGGCTGAGAATTCTTAAGACAGG + Intronic
989815604 5:45733743-45733765 AGGCTGGACAGTCCAAAATCTGG + Intergenic
990183654 5:53190441-53190463 AAACTGAAAATTCCAAATACTGG - Intergenic
990721260 5:58699009-58699031 AAGCTGAAAATACTAAAAATCGG - Intronic
990858087 5:60294084-60294106 AGGTTGAAAACACCAAATACTGG - Intronic
990899034 5:60729927-60729949 AGGCTGATGATTCCAAAAACCGG + Intergenic
991025608 5:62026345-62026367 AGGATGAAAATTCCAAAAACCGG - Intergenic
991185680 5:63804041-63804063 GGGCTGAGAAGTCCAAAATCAGG + Intergenic
991540178 5:67719237-67719259 AGCCTGAAAATACCAAGTACTGG + Intergenic
991560374 5:67945043-67945065 AGGCTAAAAATTTCAGAATCTGG + Intergenic
993402805 5:87473637-87473659 ATGTTAGAAATTCCAAAAACTGG + Intergenic
993449972 5:88061421-88061443 GGGCTCAAAATTGCAAAAAAAGG + Intergenic
993546715 5:89220965-89220987 AAGCTGAAAATTCTGAAAACTGG + Intergenic
994398439 5:99248474-99248496 AGGCTGACAATTAGTAAAACTGG - Intergenic
994615920 5:102104194-102104216 AGACTGAGAAGTCCAAAATCAGG + Intergenic
994917924 5:106003957-106003979 ATGCTGAAAATTCCAAAAACAGG - Intergenic
995480490 5:112587370-112587392 AGGCTGAAAATTCCAAAAAACGG + Intergenic
995695862 5:114877283-114877305 AATTTGAAAATTACAAAAACCGG + Intergenic
996782081 5:127198218-127198240 AAGCTGAAAATTCTAAAAACCGG + Intergenic
997393383 5:133535199-133535221 AGGCTGCAAAGTCCAAGATCAGG - Intronic
997668734 5:135653121-135653143 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
998302784 5:141041104-141041126 AGGCTAAAAATCCCAAAACAAGG + Intergenic
998416067 5:141946725-141946747 TGGCTGGGAATTCAAAAAACTGG + Intronic
1000194646 5:158946266-158946288 AGGCTGAAAATGCCAAAAACCGG - Intronic
1000283778 5:159807800-159807822 TGACTGAAAATTCCAACATCTGG - Intergenic
1000825883 5:166042813-166042835 CTACTAAAAATTCCAAAAACTGG - Intergenic
1000962065 5:167611687-167611709 AGGTTGGAAAGTCCAAAATCAGG + Intronic
1001346276 5:170902602-170902624 AGGCTGAAAATTCCAAAAACTGG - Intronic
1002464138 5:179396909-179396931 AGACTGAAAATACCAAATATTGG + Intergenic
1003049792 6:2769146-2769168 AGATTAAAAATTCCTAAAACTGG - Intronic
1003102281 6:3186015-3186037 TGGCTGAACATGCCAAAAATAGG + Intergenic
1003656007 6:8009281-8009303 AGATTAAAAATTCCAAAATCAGG + Intronic
1004622099 6:17340010-17340032 AGGCTGAAAAGTCCCACAACAGG - Intergenic
1004996019 6:21193958-21193980 AGGCTGAGAAGTCCAAGATCAGG + Intronic
1005143662 6:22663087-22663109 AGGCTGAAAAGGCTAAAAAGTGG + Intergenic
1005698636 6:28376895-28376917 AGGCACAATATTTCAAAAACAGG + Intergenic
1005790012 6:29290258-29290280 AGGCAGAACTTCCCAAAAACAGG - Intergenic
1006696514 6:35935005-35935027 AGACTGATAACTCCAAAAAGTGG - Intergenic
1009044098 6:58216649-58216671 AGGCTGAGAAGTCCCACAACTGG - Intergenic
1009219921 6:60970917-60970939 AGGCTGAGAAGTCCCACAACTGG - Intergenic
1009453705 6:63830127-63830149 AAGTTGAAAATTCTAAAAATCGG + Intronic
1009688370 6:66992360-66992382 ATCCTGAAAATTCCAAAAGTCGG - Intergenic
1009695037 6:67091659-67091681 ATGCTGAAAATTAGAAAAAAAGG + Intergenic
1010677066 6:78757172-78757194 AAGCTGAAAATTCCAAAAACCGG + Intergenic
1011169767 6:84492544-84492566 AGGCTTAAAATTAGAACAACAGG + Intergenic
1012606208 6:101160463-101160485 AGGCTGAAAATCCTATAAACAGG - Intergenic
1012799148 6:103802905-103802927 AAGCTGAAAATTCTAAAAATCGG + Intergenic
1012863551 6:104591234-104591256 AGGCTAAAAATTTAATAAACAGG - Intergenic
1012887667 6:104863847-104863869 AGGTTGAAAATCCCAAGAAATGG + Intergenic
1013004363 6:106058222-106058244 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
1013578212 6:111506805-111506827 AAGCTGAAAATTCTAAAAACCGG - Intergenic
1014141851 6:117952798-117952820 AGGCTAAAAATTATAAACACAGG - Intronic
1015330700 6:131975469-131975491 ATGCTGGAAATTACAAAGACTGG - Intergenic
1015359106 6:132315893-132315915 AAGCTGAAAAGTTAAAAAACTGG + Intronic
1015558312 6:134485568-134485590 AGAGTAGAAATTCCAAAAACAGG - Intergenic
1016122043 6:140355961-140355983 GAGCTAAAAATTTCAAAAACAGG + Intergenic
1016321057 6:142846192-142846214 AGTCTGTAAATTCCAAGCACTGG + Intronic
1016483621 6:144508942-144508964 TGGCTAAACATTCTAAAAACTGG - Intronic
1017013052 6:150077405-150077427 TGGCTGCAAATTTTAAAAACTGG - Intergenic
1017277154 6:152582743-152582765 ACACTGAAAACTCCAAAAAAGGG - Intronic
1017642730 6:156510060-156510082 AGGCTGGAAACTCCAATATCGGG - Intergenic
1017689102 6:156945503-156945525 AGTCAGGAAATTCTAAAAACAGG - Intronic
1018558065 6:165070529-165070551 ACGCTGACAATACCAAATACTGG + Intergenic
1018891664 6:167987393-167987415 AGGCTGGAAAATCCAAGACCAGG + Intergenic
1019802019 7:3094925-3094947 AGGCTGCAAATTAGAAAAATGGG - Intergenic
1019861152 7:3659297-3659319 AGGCTGGAAATTCTGAGAACAGG - Intronic
1020753297 7:12169945-12169967 AGGCTGAAAATTCCAAAAACCGG - Intergenic
1021078615 7:16335724-16335746 TGGTTGAAAATTCCCAAATCTGG + Intronic
1022866786 7:34429889-34429911 AGTCTGAGAATTCCAAGATCAGG - Intergenic
1023155589 7:37248454-37248476 TGGCAGAAAATTCCCTAAACAGG - Intronic
1023683419 7:42712060-42712082 AGGCTGATAAGTCCCAAGACAGG + Intergenic
1024103914 7:46061289-46061311 AGGCTGAAAACTCACAAATCAGG + Intergenic
1024583706 7:50823029-50823051 AGGCAGGAAATTGCAAATACTGG - Intergenic
1024734554 7:52290484-52290506 AGGCAAAAAATACCAAAGACAGG + Intergenic
1025289855 7:57707302-57707324 AGGCTGGAAAGTCCAAGATCAGG - Intergenic
1025638364 7:63344611-63344633 AGGCTGAGAAGTCCAAGACCAGG + Intergenic
1025644332 7:63403478-63403500 AGGCTGAGAAGTCCAAGACCAGG - Intergenic
1025740818 7:64193900-64193922 AGGCAGATTAATCCAAAAACAGG - Intronic
1026148308 7:67767422-67767444 AGGCTGAAAATTGCAAGGACTGG + Intergenic
1027622976 7:80515264-80515286 ATGCTGGAAATTGCCAAAACAGG + Intronic
1028218400 7:88163963-88163985 AGGCTTACAATTCCAAAACAGGG - Intronic
1028335719 7:89652068-89652090 AGGCTGAATAAGCCAAATACAGG - Intergenic
1029317941 7:99731509-99731531 AGGATGAGAATCCCAAAATCAGG - Intronic
1029345833 7:99977992-99978014 AGCCTGAGAATTCCAAAGTCTGG - Intergenic
1029953446 7:104611718-104611740 AGGCAGAAAATACTAAAAAAGGG + Intronic
1030705522 7:112689250-112689272 AGGATGAAAATTCCAAAAACCGG - Intergenic
1030732200 7:113003517-113003539 TGGCTGAACACTCCAAAAAGAGG - Intergenic
1030936812 7:115594640-115594662 AAGCTGAAAATTCTAAAAATTGG + Intergenic
1031848408 7:126833494-126833516 AGGCTGGGAAGTCCAAAATCAGG + Intronic
1032362507 7:131269292-131269314 AGGCTGTAAAGTCCAAGATCAGG + Intronic
1032900085 7:136297266-136297288 AGGCTTAAAATTCAAAATATAGG + Intergenic
1033092443 7:138398712-138398734 AGGCTGAGAAGTCCAAGATCAGG + Intergenic
1033366509 7:140676120-140676142 AGGCTGAAAATTCCAGATCAAGG + Intronic
1033390436 7:140923450-140923472 AGGCTGACTAATGCAAAAACAGG + Intronic
1033679473 7:143579980-143580002 TTGCCGAAAATGCCAAAAACCGG - Intergenic
1033692363 7:143749463-143749485 TTGCCGAAAATGCCAAAAACCGG + Intergenic
1033961028 7:146913501-146913523 AGGCTGAGAAGTCTAAAACCAGG + Intronic
1034314611 7:150118144-150118166 AGGCTGAAAATTCCAAAAACCGG + Intergenic
1034523590 7:151639811-151639833 AGGCTGAGAAGTCCCACAACAGG - Intronic
1034792289 7:153982625-153982647 AGGCTGAAAATTCCAAAAACCGG - Intronic
1036227640 8:6973209-6973231 AGGCTGAGAAGTCCAAAACAAGG - Intergenic
1036230095 8:6992368-6992390 AGGCTGAGAAGTCCAAAACAAGG - Intergenic
1036232547 8:7011471-7011493 AGGCTGAGAAGTCCAAAACAAGG - Intronic
1037050043 8:14361763-14361785 AGGCTGAAAATTCCAAAAACCGG - Intronic
1037386577 8:18349385-18349407 AGTCTGAAAAGACCAATAACAGG + Intergenic
1037418056 8:18672519-18672541 AGGCTTCAAATTTCATAAACAGG + Intronic
1037610761 8:20474144-20474166 AGGCTGTGAAGTCCAAAATCAGG - Intergenic
1038113620 8:24528174-24528196 AGGTTGGGAATTCCAAAATCAGG + Intergenic
1038984412 8:32793029-32793051 AGGCTGGGAAGTCCAAGAACTGG + Intergenic
1039025272 8:33252103-33252125 ATGCTGAAAACTCAAAAAGCCGG - Intergenic
1039575311 8:38618928-38618950 AGGCTGAGAATTACAAAACTGGG + Intergenic
1039700219 8:39954446-39954468 GGGCTTAAAATACCACAAACAGG + Intronic
1041696137 8:60738761-60738783 AGGCAGAGAAGTTCAAAAACTGG - Intronic
1041838214 8:62241321-62241343 AGGCTGAAAATTGCAAAAATAGG - Intergenic
1042534466 8:69844349-69844371 AAGCTGAAAATTCTAAAACTCGG + Intergenic
1043121937 8:76337553-76337575 AAGCTGAAAATGCCAAATTCTGG + Intergenic
1043773259 8:84231998-84232020 AGGCAGATTATTCCAAAAAAAGG + Intronic
1043835690 8:85043400-85043422 AGACTGAAAATTACAAGACCTGG - Intergenic
1044166208 8:88987057-88987079 AGGGTGCAAATTCCACAAACTGG - Intergenic
1046336266 8:112792295-112792317 AGGCTGTGAATTCCAAGATCAGG + Intronic
1046608016 8:116391770-116391792 AAGCTGAAAATTCTAAAAATCGG + Intergenic
1046796306 8:118376507-118376529 AGGCTGAGAAGTCCAAGATCAGG - Intronic
1047044068 8:121032185-121032207 AGGCTGAAAAATATAAAAACTGG - Intergenic
1047145340 8:122192576-122192598 AGGCTGGAAAGTCCAAGACCAGG + Intergenic
1049074498 8:140383228-140383250 AAACTGAAAATTCTAAAAATCGG + Intronic
1049872255 8:144989877-144989899 ACACTGAAAATTCCAAAAACCGG - Intergenic
1049950402 9:638260-638282 AGGCTGAGAAGTCCAAGATCAGG + Intronic
1050246557 9:3696155-3696177 AGGCTGAAAAGTACTAAAAAGGG - Intergenic
1050682220 9:8125158-8125180 ATGCAAAAAATTCCTAAAACAGG + Intergenic
1051180169 9:14403436-14403458 AGTCTGAAAATTACAAAATATGG - Intergenic
1051918575 9:22236706-22236728 AGGCTGAAACTTTTAAAAATTGG - Intergenic
1051924055 9:22301600-22301622 AGGCTGAAAACTTAAAAAATTGG + Intergenic
1052620604 9:30904126-30904148 AGCAGGAAAATTCTAAAAACTGG - Intergenic
1055628873 9:78201983-78202005 ATGCTGAAAATTCCAAAAACCGG + Intergenic
1057586054 9:96329936-96329958 AGGCTAAAAAGTCCCAAGACAGG + Intronic
1057762710 9:97889643-97889665 AGGGTGCAAATGCCAAAATCAGG + Intergenic
1057847198 9:98534713-98534735 ACGCTGACAATACCAAATACTGG + Intronic
1057895067 9:98902697-98902719 AGGCTGAAAAGTCCAAAGTCAGG - Intergenic
1058491509 9:105505557-105505579 ATGTAGAAAATTCAAAAAACAGG - Intronic
1058975436 9:110121626-110121648 TGACAGAAAGTTCCAAAAACAGG - Intronic
1059070813 9:111134024-111134046 CGGCTGAAAATTCCTAAAATCGG + Intergenic
1059180822 9:112210518-112210540 AGGCTGATAAGTCTTAAAACAGG - Intergenic
1061892796 9:133631569-133631591 AAGCTGAAAATGCAAAAATCAGG + Intergenic
1185791909 X:2933558-2933580 AGAATGAAAATACCATAAACTGG - Intergenic
1186420998 X:9426382-9426404 TGGCTGGAAATTCCAAAATTGGG + Intergenic
1186540715 X:10397137-10397159 AGACACAAAATTCAAAAAACAGG - Intergenic
1186681637 X:11881133-11881155 ATGCTGACAATTCCAAATGCTGG + Intergenic
1188561126 X:31470255-31470277 AGCCTGAAAATTCCAAAAACCGG - Intronic
1188605132 X:32018978-32019000 ATGCTGGAACTTGCAAAAACAGG - Intronic
1190499028 X:51056855-51056877 AGGCTGAGAAGTCCAGAGACAGG - Intergenic
1190887640 X:54543549-54543571 AGGCTCAAAATGGCAAGAACAGG - Intronic
1191602064 X:63018937-63018959 AAGCTGAAAATTATAAAAATGGG + Intergenic
1191966615 X:66766184-66766206 ATGCTGAAAATTCCAAAAACCGG - Intergenic
1192140340 X:68641871-68641893 AGGCTGAGAAGTCCCACAACAGG - Intergenic
1192419356 X:71015219-71015241 AGGCTGAGAAATCCCACAACAGG + Intergenic
1192633883 X:72800338-72800360 CGGCTGAAATTTCCCAAATCTGG - Intronic
1192647827 X:72920463-72920485 CGGCTGAAATTTCCCAAATCTGG + Intronic
1192662252 X:73053429-73053451 AGGTTGAAAATTCCCAAAACCGG + Intergenic
1192686128 X:73306828-73306850 ACACTGAAAATTCCAAACACCGG + Intergenic
1192931924 X:75815255-75815277 AGGCTGAAAATTCCAAAAACCGG + Intergenic
1193330420 X:80229973-80229995 AGGCAGAGAAATCCTAAAACAGG + Intergenic
1193341194 X:80351731-80351753 AGACTGAAAATTCCAAAAACCGG - Intronic
1193402702 X:81064701-81064723 AAGCTGAAAATTCTAAAAACCGG + Intergenic
1193570891 X:83141378-83141400 AGGCTGAAAAGTCCCAAGATAGG - Intergenic
1194047364 X:89024759-89024781 AGGTTGAAAAGTCCAAGATCAGG + Intergenic
1194098692 X:89675178-89675200 AGGCTGAAAATTCCAAAAACAGG + Intergenic
1195019710 X:100814776-100814798 AGGCTGATAAGTCCCACAACAGG + Intergenic
1195062267 X:101207728-101207750 AGGCTGGAAAGTCCAAAATCAGG + Intergenic
1196489965 X:116253756-116253778 AAACTGAAAATTCTAAAAATTGG + Intergenic
1196493706 X:116298456-116298478 AGACTGATGATTCCTAAAACTGG + Intergenic
1197788440 X:130224313-130224335 AGGCTGTAAAGTCCAAGATCAGG - Intronic
1198123866 X:133622216-133622238 AAGCTGAAAATTCTAAAAATCGG + Intronic
1198572454 X:137972027-137972049 AGACTGAAAATTCCAAAAACTGG + Intergenic
1199178009 X:144815184-144815206 AAGATAAAAACTCCAAAAACTGG + Intergenic
1199504982 X:148551706-148551728 ACCCTGCATATTCCAAAAACAGG + Intronic
1200451715 Y:3336552-3336574 AGGCTGAAAATTCCAAAAACAGG + Intergenic
1200731897 Y:6751993-6752015 ATGCTGAAAACTCAAAAAGCCGG - Intergenic
1201393021 Y:13519382-13519404 AAGCTGAAAATTCTAAATATCGG - Intergenic
1201409445 Y:13684104-13684126 AGGCTAGCAATTCCAAAACCTGG + Intergenic
1201922289 Y:19246297-19246319 ATGCCAAAAATTCCAAAAACTGG + Intergenic
1201961822 Y:19689584-19689606 AGTCTGAAAATTCCAAAAACTGG - Intergenic