ID: 1090720530

View in Genome Browser
Species Human (GRCh38)
Location 11:129468123-129468145
Sequence GAATGCCTCTTCTCATCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090720525_1090720530 28 Left 1090720525 11:129468072-129468094 CCATGAACATGAGAAAAAGGAGC No data
Right 1090720530 11:129468123-129468145 GAATGCCTCTTCTCATCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090720530 Original CRISPR GAATGCCTCTTCTCATCCAA AGG Intergenic
No off target data available for this crispr