ID: 1090722389

View in Genome Browser
Species Human (GRCh38)
Location 11:129488318-129488340
Sequence ATAAGGTAGTCCCTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090722389_1090722397 9 Left 1090722389 11:129488318-129488340 CCCTCAGGGAGGGACTACCTTAT No data
Right 1090722397 11:129488350-129488372 TACTCTCCAGTGCCAGGTCCAGG No data
1090722389_1090722398 10 Left 1090722389 11:129488318-129488340 CCCTCAGGGAGGGACTACCTTAT No data
Right 1090722398 11:129488351-129488373 ACTCTCCAGTGCCAGGTCCAGGG No data
1090722389_1090722394 3 Left 1090722389 11:129488318-129488340 CCCTCAGGGAGGGACTACCTTAT No data
Right 1090722394 11:129488344-129488366 GTTCCCTACTCTCCAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090722389 Original CRISPR ATAAGGTAGTCCCTCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr