ID: 1090723903

View in Genome Browser
Species Human (GRCh38)
Location 11:129504450-129504472
Sequence CTTTGTAACCAAAAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090723903_1090723906 16 Left 1090723903 11:129504450-129504472 CCTACCACCTTTTGGTTACAAAG No data
Right 1090723906 11:129504489-129504511 CTCTTAAAGAAATTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090723903 Original CRISPR CTTTGTAACCAAAAGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr