ID: 1090726201

View in Genome Browser
Species Human (GRCh38)
Location 11:129529514-129529536
Sequence GTGTATGAAAGGCAGCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090726201_1090726207 26 Left 1090726201 11:129529514-129529536 CCTCTATGCTGCCTTTCATACAC No data
Right 1090726207 11:129529563-129529585 CAGTGAGAACTCACACGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090726201 Original CRISPR GTGTATGAAAGGCAGCATAG AGG (reversed) Intergenic
No off target data available for this crispr