ID: 1090731368

View in Genome Browser
Species Human (GRCh38)
Location 11:129575644-129575666
Sequence GTGGAGGTGAGCCGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090731368_1090731375 17 Left 1090731368 11:129575644-129575666 CCTGCCTCCCGGCTCACCTCCAC No data
Right 1090731375 11:129575684-129575706 CTCCACCAGCTTCCCATCCTGGG No data
1090731368_1090731374 16 Left 1090731368 11:129575644-129575666 CCTGCCTCCCGGCTCACCTCCAC No data
Right 1090731374 11:129575683-129575705 GCTCCACCAGCTTCCCATCCTGG No data
1090731368_1090731376 18 Left 1090731368 11:129575644-129575666 CCTGCCTCCCGGCTCACCTCCAC No data
Right 1090731376 11:129575685-129575707 TCCACCAGCTTCCCATCCTGGGG No data
1090731368_1090731378 19 Left 1090731368 11:129575644-129575666 CCTGCCTCCCGGCTCACCTCCAC No data
Right 1090731378 11:129575686-129575708 CCACCAGCTTCCCATCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090731368 Original CRISPR GTGGAGGTGAGCCGGGAGGC AGG (reversed) Intergenic