ID: 1090735503

View in Genome Browser
Species Human (GRCh38)
Location 11:129609371-129609393
Sequence ACAACAGGGCTGGCAGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735503_1090735518 30 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735503_1090735508 -10 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735508 11:129609384-129609406 GCCCTGTTGTGGCCATTGGATGG No data
1090735503_1090735513 3 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735513 11:129609397-129609419 CATTGGATGGCATCCTCTGAGGG No data
1090735503_1090735514 13 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735514 11:129609407-129609429 CATCCTCTGAGGGACTCTAGAGG No data
1090735503_1090735516 23 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735516 11:129609417-129609439 GGGACTCTAGAGGACAGCAGAGG No data
1090735503_1090735517 29 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data
1090735503_1090735512 2 Left 1090735503 11:129609371-129609393 CCTAGACCTGCCAGCCCTGTTGT No data
Right 1090735512 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735503 Original CRISPR ACAACAGGGCTGGCAGGTCT AGG (reversed) Intergenic
No off target data available for this crispr