ID: 1090735505

View in Genome Browser
Species Human (GRCh38)
Location 11:129609377-129609399
Sequence ATGGCCACAACAGGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735505_1090735518 24 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735505_1090735516 17 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735516 11:129609417-129609439 GGGACTCTAGAGGACAGCAGAGG No data
1090735505_1090735519 25 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735505_1090735514 7 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735514 11:129609407-129609429 CATCCTCTGAGGGACTCTAGAGG No data
1090735505_1090735513 -3 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735513 11:129609397-129609419 CATTGGATGGCATCCTCTGAGGG No data
1090735505_1090735512 -4 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735512 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
1090735505_1090735517 23 Left 1090735505 11:129609377-129609399 CCTGCCAGCCCTGTTGTGGCCAT No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735505 Original CRISPR ATGGCCACAACAGGGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr