ID: 1090735509

View in Genome Browser
Species Human (GRCh38)
Location 11:129609385-129609407
Sequence GCCATCCAATGGCCACAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735509_1090735516 9 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735516 11:129609417-129609439 GGGACTCTAGAGGACAGCAGAGG No data
1090735509_1090735514 -1 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735514 11:129609407-129609429 CATCCTCTGAGGGACTCTAGAGG No data
1090735509_1090735518 16 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735509_1090735519 17 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735509_1090735517 15 Left 1090735509 11:129609385-129609407 CCCTGTTGTGGCCATTGGATGGC No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735509 Original CRISPR GCCATCCAATGGCCACAACA GGG (reversed) Intergenic
No off target data available for this crispr