ID: 1090735510

View in Genome Browser
Species Human (GRCh38)
Location 11:129609386-129609408
Sequence TGCCATCCAATGGCCACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735510_1090735517 14 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data
1090735510_1090735519 16 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735510_1090735516 8 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735516 11:129609417-129609439 GGGACTCTAGAGGACAGCAGAGG No data
1090735510_1090735518 15 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735510_1090735514 -2 Left 1090735510 11:129609386-129609408 CCTGTTGTGGCCATTGGATGGCA No data
Right 1090735514 11:129609407-129609429 CATCCTCTGAGGGACTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735510 Original CRISPR TGCCATCCAATGGCCACAAC AGG (reversed) Intergenic
No off target data available for this crispr