ID: 1090735511

View in Genome Browser
Species Human (GRCh38)
Location 11:129609396-129609418
Sequence CCTCAGAGGATGCCATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090735511_1090735522 30 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735522 11:129609449-129609471 AAGCCTTCTTGCATGGAAACTGG No data
1090735511_1090735519 6 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735519 11:129609425-129609447 AGAGGACAGCAGAGGCCACGGGG No data
1090735511_1090735518 5 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735518 11:129609424-129609446 TAGAGGACAGCAGAGGCCACGGG No data
1090735511_1090735517 4 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735517 11:129609423-129609445 CTAGAGGACAGCAGAGGCCACGG No data
1090735511_1090735521 23 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735521 11:129609442-129609464 ACGGGGCAAGCCTTCTTGCATGG No data
1090735511_1090735516 -2 Left 1090735511 11:129609396-129609418 CCATTGGATGGCATCCTCTGAGG No data
Right 1090735516 11:129609417-129609439 GGGACTCTAGAGGACAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090735511 Original CRISPR CCTCAGAGGATGCCATCCAA TGG (reversed) Intergenic
No off target data available for this crispr